RPAIN (NM_001160243) Human Untagged Clone

CAT#: SC326799

RPAIN (untagged)-Human RPA interacting protein (RPAIN) transcript variant 1



  "NM_001160243" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
RPAIN mouse monoclonal antibody,clone OTI6A7
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HRIP; RIP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001160243, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGTCGTTGAGGTCTCCGCGCCGCTCCCTGTACAAACTGGTGGGCTCGCCGCCT
TGGAAAGAGGCTTTCCGGCAGAGATGCCTGGAGAGAATGAGAAACAGCCGGGACAGGCTC
CTAAACAGGTACCGCCAGGCTGGAAGCAGTGGGCCAGGGAATTCTCAGAACAGCTTTCTA
GTTCAAGAGGTGATGGAAGAAGAGTGGAATGCTTTGCAGTCAGTGGAGAATTGTCCAGAA
GACTTGGCTCAGCTGGAGGAGCTGATAGACATGGCTGTGCTGGAGGAAATTCAACAGGAG
CTGATCAACCAAGAGCAGTCCATCATCAGCGAGTATGAGAAGAGCTTGCAGTTTGATGAA
AAGTGTCTCAGCATCATGCTGGCTGAGTGGGAGGCAAACCCACTCATCTGTCCTGTATGT
ACAAAGTACAACCTGAGAATCACAAGCGGTGTGGTGGTGTGTCAGTGTGGCCTGTCCATC
CCATCTCATTCTTCTGAGTTGACAGAGCAGAAGCTTCGTGCCTGTTTAGAGGGTAGTATA
AATGAGCACAGTGCACATTGTCCCCACACACCTGAATTTTCAGTCACTGGAGGAACAGAA
GAAAAGTCCAGTCTTCTCATGAGCTGTCTGGTAAGCGTCTCCTGGGACCCACTCTGTGGT
AAGAGGGACCTGTGGTTGGTTTTATTCCCACCT
Restriction Sites Please inquire     
ACCN NM_001160243
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001160243.1, NP_001153715.1
RefSeq Size 2654 bp
RefSeq ORF 696 bp
Locus ID 84268
UniProt ID Q86UA6
Gene Summary Mediates the import of RPA complex into the nucleus, possibly via some interaction with importin beta. Isoform 2 is sumoylated and mediates the localization of RPA complex into the PML body of the nucleus, thereby participating in RPA function in DNA metabolism.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...