COX11 (NM_001162862) Human Untagged Clone

CAT#: SC326800

COX11 (untagged)-Human COX11 homolog cytochrome c oxidase assembly protein (yeast) (COX11) nuclear gene encoding mitochondrial protein transcript variant 3



  "NM_001162862" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-COX11 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COX11P
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001162862, the custom clone sequence may differ by one or more nucleotides
ATGGGAGGGCTCTGGCGTCCTGGATGGAGGTGCGTTCCTTTCTGTGGCTGGCGCTGGATC
CACCCTGGGTCTCCAACCAGGGCTGCAGAGAGGGTAGAGCCGTTTCTTAGGCCAGAGTGG
AGTGGGACAGGAGGTGCCGAGAGAGGACTGAGGTGGCTTGGGACATGGAAGCGCTGCAGC
CTTCGAGCCCGGCATCCAGCATTGCAGCCGCCGCGGCGGCCTAAGAGCTCGAACCCTTTC
ACACGCGCGCAGGAGGAGGAGCGGCGGCGGCAGAACAAGACGACCCTCACTTACGTGGCC
GCTGTCGCCGTGGGCATGCTGGGGGCGTCCTACGCTGCCGTACCCCTTTATCGGCTCTAT
TGCCAGACTACTGGACTTGGAGGATCAGCAGTTGCAGGTCATGCCTCAGACAAGATTGAA
AACATGGTGCCTGTTAAAGATCGAATCATTAAAATTAGCTTTAATGCAGATGTGCATGCA
AGTCTCCAGTGGAACTTTAGACCTCAGCAAACAGAAATATATGTGGTGCCAGGAGAGACT
GCACTGGCGTTTTACAGAGCTAAGAATCCTACTGACAAACCAGTAATTGGAATTTCTACA
TACAATATTGTTCCATTTGAAGCTGGACAGTATTTCAATAAAATACAGGCTTCAAAGCTG
CACAGAGTCTACGTTTTAGAGAGTTGGCACCTT
Restriction Sites Please inquire     
ACCN NM_001162862
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001162862.1, NP_001156334.1
RefSeq Size 824 bp
RefSeq ORF 696 bp
Locus ID 1353
Protein Families Transmembrane
Protein Pathways Metabolic pathways, Oxidative phosphorylation
Gene Summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region resulting in a frameshift, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...