Aspartate beta hydroxylase (ASPH) (NM_001164754) Human Untagged Clone

CAT#: SC326865

ASPH (untagged)-Human aspartate beta-hydroxylase (ASPH) transcript variant 10



  "NM_001164754" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ASPH
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AAH; BAH; CASQ2BP1; FDLAB; HAAH; JCTN; junctin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326865 representing NM_001164754.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCAGCGTAAGAATGCCAAGAGCAGCGGCAACAGCAGCAGCAGCGGCTCCGGCAGCGGTAGCACG
AGTGCGGGCAGCAGCAGCCCCGGGGCCCGGAGAGAGACAAAGCATGGAGGACACAAGAATGGGAGGAAA
GGCGGACTCTCAGGAACTTCATTCTTCACGTGGTTTATGGTGATTGCATTGCTGGGCGTCTGGACATCT
GTAGCTGTCGTTTGGTTTGATCTTGTTGACTATGAGGAAGTTCTAGGAAAACTAGGAATCTATGATGCT
GATGGTGATGGAGATTTTGATGTGGATGATGCCAAAGTTTTATTAGGACTTAAAGAGAGATCTACTTCA
GAGCCAGCAGTCCCGCCAGAAGAGGCTGAGCCACACACTGAGCCCGAGGAGCAGGTTCCTGTGGAGGCA
GAACCCCAGAATATCGAAGATGAAGCAAAAGAACAAATTCAGTCCCTTCTCCATGAAATGGTACACGCA
GAACATGTTGAGGGAGAAGACTTGCAACAAGAAGATGGACCCACAGGAGAACCACAACAAGAGGATGAT
GAGTTTCTTATGGCGACTGATGTAGATGATAGATTTGAGACCCTGGAACCTGAAGTATCTCATGAAGAA
ACCGAGCATAGTTACCACGTGGAAGAGACAGATTCCAGTGAACCAGTAGTAGAAGATGAAAGATTGCAC
CATGATACAGATGATGTAACATACCAAGTCTATGAGGAACAAGCAGTATATGAACCTCTAGAAAATGAA
GGGATAGAAATCACAGAAGTAACTGCTCCCCCTGAGGATAATCCTGTAGAAGATTCACAGGTAATTGTA
GAAGAAGTAAGCATTTTTCCTGTGGAAGAACAGCAGGAAGTACCACCAGATACTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001164754
Insert Size 885 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164754.1
RefSeq Size 3735 bp
RefSeq ORF 885 bp
Locus ID 444
Protein Families Druggable Genome, Transmembrane
MW 32.4 kDa
Gene Summary This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (10) lacks an alternate in-frame exon and uses a distinct 3' splice pattern that lacks many coding exons, compared to variant 1. The resulting isoform (j) lacks an internal segment and has a substantially shorter and distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Aspartate beta hydroxylase产品

Customer Reviews 
Loading...