SYTL2 (NM_001162952) Human Untagged Clone

CAT#: SC326902

SYTL2 (untagged)-Human synaptotagmin-like 2 (SYTL2) transcript variant h



  "NM_001162952" in other vectors (4)

CNY 5,510.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SYTL2 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHR11SYT; EXO4; PPP1R151; SGA72M; SLP2; SLP2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326902 representing NM_001162952.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCAAGTCTGTTCCAGCATTTCTCCAAGATGAGGTGAGTGGCAGTGTGATGAGTGTTTATAGTGGA
GACTTTGGCAATCTGGAAGTTAAAGGAAATATTCAGTTTGCAATTGAATATGTGGAGTCACTGAAGGAG
TTGCATGTTTTTGTGGCCCAGTGTAAGGACTTAGCAGCAGCGGATGTAAAAAAACAGCGTTCAGACCCA
TATGTAAAGGCCTATTTGCTACCAGACAAAGGCAAAATGGGCAAGAAGAAAACACTCGTAGTGAAGAAA
ACCTTGAATCCTGTGTATAACGAAATACTGCGGTATAAAATTGAAAAACAAATCTTAAAGACACAGAAA
TTGAACCTGTCCATTTGGCATCGGGATACATTTAAGCGCAATAGTTTCCTAGGGGAGGTGGAACTTGAT
TTGGAAACATGGGACTGGGATAACAAACAGAATAAACAATTGAGATGGTACCCTCTGAAGCGGAAGACA
GCACCAGTTGCCCTTGAAGCAGAAAACAGAGGTGAAATGAAACTAGCTCTCCAGTATGTCCCAGAGCCA
GTCCCTGGTAAAAAGCTTCCTACAACTGGAGAAGTGCACATCTGGGTGAAGGAATGCCTTGATCTACCA
CTGCTAAGGGGAAGTCATCTAAATTCTTTTGTTAAATGTACCATCCTTCCAGATACAAGTAGGAAAAGT
CGCCAGAAGACAAGAGCTGTAGGGAAAACCACCAACCCTATCTTCAACCACACTATGGTGTATGATGGG
TTCAGGCCTGAAGATCTGATGGAAGCCTGTGTAGAGCTTACTGTCTGGGACCATTACAAATTAACCAAC
CAATTTTTGGGAGGTCTTCGTATTGGCTTTGGAACAGGTAAAAGTTATGGGACTGAAGTGGACTGGATG
GACTCTACTTCAGAGGAAGTTGCTCTCTGGGAGAAGATGGTAAACTCCCCCAATACTTGGATTGAAGCA
ACACTGCCTCTCAGAATGCTTTTGATTGCCAAGATTTCCAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001162952
Insert Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001162952.2
RefSeq Size 2672 bp
RefSeq ORF 1011 bp
Locus ID 54843
UniProt ID Q9HCH5
MW 38.5 kDa
Gene Summary The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jun 2009]
Transcript Variant: This variant (h) lacks several 5' exons but contains an alternate 5' exon, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant a. The encoded isoform (h) is shorter at the N-terminus, compared to isoform a. Both variants h and l encode isoform h.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...