Tryptophan rich protein (WRB) (NM_001146218) Human Untagged Clone
CAT#: SC327369
WRB (untagged)-Human tryptophan rich basic protein (WRB) transcript variant 2
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHD5; WRB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327369 representing NM_001146218.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCAGGGTGCTGCAGAAGGACGCGGAGCAGGAGTCACAGATGAGAGCGGAGATCCAGGACATGAAG CAGGAGCTCTCCACAGTCAACATGATGGACGAGTTTGCCAGATATGCCAGGCTGGAAAGAAAGATCAAC AAGATGACGGATAAGCTCAAAACCCATGTGAAAGCTCGGACAGCTCAATTAGCCAAGATAAAATGGGTG ATAAGTGTCGCTTTCTACGTATTGCAGGCTGCCCTGATGATCTCACTCATTTGGAAGTATTATTCTGTC CCTGTGGCTGTCGTGCCGAGTAAATGGATAACCCCTCTAGACCGCCTGGTAGCCTTTCCTACTAGAGTA GCAGGTGGTGTTGGAATTACCTGTTGGATTTTAGTCTGTAACAAAGTTGTCGCTATTGTGCTTCATCCG TTCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146218 |
Insert Size | 423 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146218.1 |
RefSeq Size | 1470 bp |
RefSeq ORF | 423 bp |
Locus ID | 7485 |
UniProt ID | O00258 |
Protein Families | Transmembrane |
MW | 16 kDa |
Gene Summary | This gene is located in the candidate region for congenital heart disease (CHD) in Down syndrome (DS). It encodes a basic protein that functions as a receptor that promotes insertion of tail-anchored proteins in the endoplasmic reticulum membrane. This gene is located at a maternally-methylated differentially methylated region (DMR); however, its transcription may be biallelic, not imprinted. Alternative splicing results in different transcript variants. A pseudogene has been defined on chromosome 4. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (2) represents use of an alternate promoter compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Identification of Significant Amino Acids in Multiple Transmembrane Domains of Human Transient Receptor Potential Ankyrin 1 (TRPA1) for Activation by Eudesmol, an Oxygenized Sesquiterpene in Hop Essential Oil
,null,
The Journal of Biological Chemistry
,PubMed ID 25525269
[GET1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228734 | WRB (Myc-DDK-tagged)-Human tryptophan rich basic protein (WRB), transcript variant 2 |
CNY 2,400.00 |
|
RC228734L3 | Lenti ORF clone of Human tryptophan rich basic protein (WRB), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228734L4 | Lenti ORF clone of Human tryptophan rich basic protein (WRB), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG228734 | WRB (tGFP-tagged) - Human tryptophan rich basic protein (WRB), transcript variant 2 |
CNY 4,370.00 |
其它Tryptophan rich protein产品