MAFF (NM_001161573) Human Untagged Clone

CAT#: SC327379

MAFF (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF) transcript variant 4



  "NM_001161573" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-MAFF Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hMafF; U-MAF
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001161573, the custom clone sequence may differ by one or more nucleotides
ATGTCTGTGGATCCCCTATCCAGCAAAGCTCTAAAGATCAAGCGAGAGCTGAGCGAGAAC
ACGCCGCACCTGTCGGACGAGGCGCTGATGGGGCTGTCGGTGCGCGAGCTGAACCGGCAT
CTGCGCGGGCTCTCCGCCGAGGAGGTGACACGGCTCAAGCAGCGGCGCCGCACACTCAAA
AACCGTGGCTACGCCGCCAGCTGCCGCGTGAAGCGCGTGTGCCAGAAGGAGGAGCTGCAG
AAGCAGAAGTCGGAGCTGGAGCGCGAGGTGGACAAGCTGGCGCGCGAGAACGCCGCCATG
CGCCTGGAGCTCGACGCGCTGCGCGGCAAGTGCGAGGCGCTGCAGGGCTTCGCGCGCTCC
GTGGCCGCCGCCCGCGGGCCCGCCACGCTCGTGGCGCCGGCCAGCGTCATCACCATCGTC
AAGTCCACCCCGGGCTCGGGGTCTGGCCCCGCCCACGGCCCGGACCCCGCCCACGGCCCG
GCCTCCTGCTCC
Restriction Sites Please inquire     
ACCN NM_001161573
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001161573.1, NP_001155045.1
RefSeq Size 2234 bp
RefSeq ORF 495 bp
Locus ID 23764
UniProt ID Q9ULX9
Protein Families Druggable Genome, Transcription Factors
Gene Summary The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. The encoded protein can also form homodimers, and since it lacks a transactivation domain, the homodimer may act as a repressor of transcription. This gene may also be involved in the cellular stress response. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 3. Variants 1, 3, and 4 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...