ZNF580 (NM_001163423) Human Untagged Clone
CAT#: SC327381
ZNF580 (untagged)-Human zinc finger protein 580 (ZNF580) transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327381 representing NM_001163423.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGCTGCTGCCGCCGCGGCCACCCCACCCTCGGTCCTCCTCTCCGGAGGCCATGGACCCACCGCCC CCCAAGGCTCCCCCTTTCCCCAAGGCGGAAGGCCCCTCCTCCACTCCTTCCTCGGCGGCGGGGCCCCGA CCCCCGCGGCTGGGCCGCCACCTCCTCATCGACGCCAATGGGGTCCCCTACACATACACGGTGCAGCTG GAGGAGGAGCCCCGGGGCCCGCCCCAGCGCGAGGCGCCCCCAGGAGAGCCCGGCCCTCGCAAGGGCTAC AGCTGCCCGGAGTGCGCCCGTGTCTTTGCCAGCCCTCTGCGGCTGCAGAGCCACCGCGTGTCGCACTCG GACCTCAAGCCCTTCACGTGCGGCGCCTGCGGCAAGGCCTTCAAGCGCTCCAGCCACCTGTCGCGGCAT CGCGCCACGCACCGCGCCCGCGCCGGGCCGCCGCACACCTGCCCGCTCTGCCCACGCCGCTTCCAGGAC GCCGCGGAGCTGGCGCAGCACGTGCGCCTCCACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163423 |
Insert Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001163423.1 |
RefSeq Size | 1046 bp |
RefSeq ORF | 519 bp |
Locus ID | 51157 |
UniProt ID | Q9UK33 |
Protein Families | Transcription Factors |
MW | 18.8 kDa |
Gene Summary | Involved in the regulation of endothelial cell proliferation and migration. Mediates H(2)O(2)-induced leukocyte chemotaxis by elevating interleukin-8 production and may play a role in inflammation. May be involved in transcriptional regulation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228746 | ZNF580 (Myc-DDK-tagged)-Human zinc finger protein 580 (ZNF580), transcript variant 3 |
CNY 2,400.00 |
|
RC228746L3 | Lenti ORF clone of Human zinc finger protein 580 (ZNF580), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228746L4 | Lenti ORF clone of Human zinc finger protein 580 (ZNF580), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG228746 | ZNF580 (tGFP-tagged) - Human zinc finger protein 580 (ZNF580), transcript variant 3 |
CNY 4,370.00 |