NNT1 (CLCF1) (NM_001166212) Human Untagged Clone
CAT#: SC327400
CLCF1 (untagged)-Human cardiotrophin-like cytokine factor 1 (CLCF1) transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BSF-3; BSF3; CISS2; CLC; NNT-1; NNT1; NR6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327400 representing NM_001166212.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTAGCGTGCCTGTGCACGGTGCTCTGGCACCTCCCTGCAGTGCCAGCTCTCAATCGCACAGGGGAC CCAGGGCCTGGCCCCTCCATCCAGAAAACCTATGACCTCACCCGCTACCTGGAGCACCAACTCCGCAGC TTGGCTGGGACCTATCTGAACTACCTGGGCCCCCCTTTCAACGAGCCAGACTTCAACCCTCCCCGCCTG GGGGCAGAGACTCTGCCCAGGGCCACTGTTGACTTGGAGGTGTGGCGAAGCCTCAATGACAAACTGCGG CTGACCCAGAACTACGAGGCCTACAGCCACCTTCTGTGTTACTTGCGTGGCCTCAACCGTCAGGCTGCC ACTGCTGAGCTGCGCCGCAGCCTGGCCCACTTCTGCACCAGCCTCCAGGGCCTGCTGGGCAGCATTGCG GGCGTCATGGCAGCTCTGGGCTACCCACTGCCCCAGCCGCTGCCTGGGACTGAACCCACTTGGACTCCT GGCCCTGCCCACAGTGACTTCCTCCAGAAGATGGACGACTTCTGGCTGCTGAAGGAGCTGCAGACCTGG CTGTGGCGCTCGGCCAAGGACTTCAACCGGCTCAAGAAGAAGATGCAGCCTCCAGCAGCTGCAGTCACC CTGCACCTGGGGGCTCATGGCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166212 |
Insert Size | 648 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001166212.1 |
RefSeq Size | 1779 bp |
RefSeq ORF | 648 bp |
Locus ID | 23529 |
UniProt ID | Q9UBD9 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
MW | 24.1 kDa |
Gene Summary | This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus when compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228765 | CLCF1 (Myc-DDK-tagged)-Human cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2 |
CNY 2,400.00 |
|
RC228765L3 | Lenti ORF clone of Human cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228765L4 | Lenti ORF clone of Human cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG228765 | CLCF1 (tGFP-tagged) - Human cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2 |
CNY 4,370.00 |