Syntaxin 1a (STX1A) (NM_001165903) Human Untagged Clone

CAT#: SC327419

STX1A (untagged)-Human syntaxin 1A (brain) (STX1A) transcript variant 2



  "NM_001165903" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
STX1A mouse monoclonal antibody,clone OTI2D11
    • 100 ul

CNY 1,999.00
CNY 3,490.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HPC-1; P35-1; STX1; SYN1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327419 representing NM_001165903.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAAGGACAGCGATGATGATGATGATGTCGCTGTCACC
GTGGACCGAGACCGCTTCATGGATGAGTTCTTTGAGCAGGTGGAGGAGATTCGAGGCTTCATTGACAAG
ATCGCAGAGAACGTGGAGGAGGTGAAGCGGAAGCACAGTGCCATCCTGGCATCCCCCAACCCCGATGAG
AAGACGAAGGAGGAGCTGGAAGAACTCATGTCCGACATAAAGAAGACAGCAAACAAAGTTCGTTCCAAG
TTAAAGAGCATCGAGCAGTCCATCGAGCAAGAGGAAGGCCTGAACCGCTCCTCCGCTGACCTGAGGATC
CGGAAGACACAGCACTCCACGCTGTCCAGAAAGTTTGTGGAGGTCATGTCGGAGTACAACGCCACGCAG
TCCGACTACCGCGAGCGCTGCAAAGGCCGCATCCAGAGGCAGCTGGAGATCACCGGCAGGACCACGACC
AGTGAGGAGCTGGAGGACATGCTGGAGAGTGGGAACCCCGCCATCTTTGCCTCTGGGATCATCATGGAC
TCCAGCATCTCGAAGCAGGCTCTGAGCGAGATTGAGACGCGGCACAGTGAGATCATCAAGCTGGAGAAC
AGCATCCGTGAGCTACACGACATGTTCATGGACATGGCCATGCTCGTGGAGAGCCAGACTATGTGGAGA
GGGCCGTGTCTGACACCAAGAAGGCCGTCAAGTACCAGAGCAAGGCGCGCCGGAAGAAAATCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001165903
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001165903.1
RefSeq Size 2092 bp
RefSeq ORF 756 bp
Locus ID 6804
UniProt ID Q16623
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 29 kDa
Gene Summary This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor] domain (known as H3), and an N-terminal regulatory domain (Habc). Syntaxins bind synaptotagmin in a calcium-dependent fashion and interact with voltage dependent calcium and potassium channels via the C-terminal H3 domain. This gene product is a key molecule in ion channel regulation and synaptic exocytosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Transcript Variant: This variant (2) lacks an internal segment in the 3' coding region, as compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...