TBX20 (NM_001166220) Human Untagged Clone

CAT#: SC327450

TBX20 (untagged)-Human T-box 20 (TBX20) transcript variant 2



  "NM_001166220" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TBX20 mouse monoclonal antibody,clone OTI5D4
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASD4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327450 representing NM_001166220.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTTCACGGCGTCCCCCAAGCCCCAACTCTCCTCTCGGGCCAACGCCTTCTCCATTGCCGCGCTC
ATGTCGAGCGGCGGCTCTAAGGAGAAGGAGGCGACGGAGAACACAATCAAACCCCTGGAGCAATTTGTG
GAGAAGTCGTCCTGTGCCCAGCCCCTGGGTGAGCTGACCAGCCTGGATGCTCATGGGGAGTTTGGTGGA
GGCAGTGGCAGCAGCCCGTCCTCCTCCTCTCTGTGCACTGAGCCACTGATCCCCACCACCCCCATCATC
CCCAGTGAGGAAATGGCCAAAATTGCCTGCAGCCTGGAGACCAAGGAGCTTTGGGACAAATTCCATGAG
CTGGGCACCGAGATGATCATCACCAAGTCGGGCAGGAGGATGTTTCCAACCATCCGGGTGTCCTTTTCG
GGGGTGGATCCTGAGGCCAAGTACATAGTCCTGATGGACATCGTCCCTGTGGACAACAAGAGGTACCGC
TACGCCTACCACCGGTCCTCCTGGCTGGTGGCTGGCAAGGCCGACCCGCCGTTGCCAGCCAGGCTCTAT
GTGCATCCAGATTCTCCTTTTACCGGTGAGCAACTACTCAAACAGATGGTGTCTTTTGAAAAGGTGAAA
CTCACCAACAATGAACTGGATCAACATGGCCATATAATTTTGAACTCAATGCATAAGTACCAGCCAAGG
GTGCACATCATTAAGAAGAAAGACCACACAGCCTCATTGCTCAACCTGAAGTCTGAAGAATTTAGAACT
TTCATCTTTCCAGAAACAGTTTTTACGGCAGTCACTGCCTACCAGAATCAACTGATAACGAAGCTGAAA
ATAGATAGCAATCCTTTTGCCAAAGGATTCCGGGATTCCTCCAGGCTCACTGACATTGAGAGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166220
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166220.1
RefSeq Size 1374 bp
RefSeq ORF 894 bp
Locus ID 57057
UniProt ID Q9UMR3
Protein Families Transcription Factors
MW 33.2 kDa
Gene Summary This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) has an alternate 3' end, as compared to variant 1. The resulting isoform (2) is C-terminal truncated, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...