STAU2 (NM_001164383) Human Untagged Clone
CAT#: SC327508
STAU2 (untagged)-Human staufen RNA binding protein homolog 2 (Drosophila) (STAU2) transcript variant 4
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 39K2; 39K3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164383, the custom clone sequence may differ by one or more nucleotides
ATGAAAGCCCTCCAAGCACTGCAGAATGAACCTATTCCAGAAAGATCTCCTCAGAATGGT GAATCAGGAAAGGATGTGGATGATGACAAAGATGCAAATAAGTCTGAGATCAGCTTAGTG TTTGAAATTGCTCTGAAGCGAAATATGCCTGTCAGTTTTGAGGTTATTAAAGAAAGTGGA CCACCACATATGAAAAGCTTTGTTACTCGAGTGTCAGTAGGAGAGTTCTCTGCAGAAGGA GAAGGAAATAGCAAAAAACTCTCCAAGAAGCGCGCTGCGACCACCGTCTTACAGGAGCTT AAAAAACTTCCACCTCTTCCTGTGGTGGAAAAGCCAAAACTATTTTTTAAAAAACGCCCT AAAACAATAGTAAAGGCCGGACCAGAATATGGCCAAGGGATGAACCCTATTAGCCGCCTG GCGCAAATTCAACAGGCCAAAAAGGAAAAGGAGCCGGATTATGTTTTGCTTTCAGAAAGA GGAATGCCTCGACGTCGAGAATTTGTGATGCAGGTGAAGGTAGGCAATGAAGTTGCTACA GGAACAGGACCTAATAAAAAGATAGCCAAAAAAAATGCTGCAGAAGCAATGCTGTTACAA CTTGGTTATAAAGCATCCACTAATCTTCAGGATCAACTTGAGAAGACAGGGGAAAACAAA GGATGGAGTGGTCCAAAGCCTGGGTTTCCTGAACCAACAAATAATACTCCAAAAGGAATT CTTCATTTGTCTCCTGATGTTTATCAAGAGATGGAAGCCAGCCGCCACAAAGTAATCTCT GGCACTACTCTAGGCTATTTGTCACCCAAAGATATGAACCAACCTTCAAGCTCTTTCTTC AGTATATCTCCCACATCGAATAGTTCAGCTACAATTGCCAGGGAACTCCTTATGAATGGA ACATCTTCTACAGCTGAAGCCATAGGTTTAAAAGGAAGTTCTCCTACTCCCCCTTGTTCT CCAGTACAACCTTCAAAACAACTGGAATATTTAGCAAGGATTCAAGGCTTTCAGGCAGCC TTAAGTGCCTTGAAACAATTTTCTGAACAAGGACTGGATCCAATCGATGGAGCAATGAAT ATCGAAAAAGGTTCTCTTGAAAAACAAGCCAAGCATCTGAGAGAGAAAGCGGACAATAAC CAGGCACCCCCGGGCTCCATCGCTCAGGACTGCAAGAAATCAAACTCGGCCGTC |
Restriction Sites | Please inquire |
ACCN | NM_001164383 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164383.1, NP_001157855.1 |
RefSeq Size | 2459 bp |
RefSeq ORF | 1197 bp |
Locus ID | 27067 |
UniProt ID | Q9NUL3 |
Protein Families | Transcription Factors |
Gene Summary | Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009] Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (d) has a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228873 | STAU2 (Myc-DDK-tagged)-Human staufen, RNA binding protein, homolog 2 (Drosophila) (STAU2), transcript variant 4 |
CNY 3,990.00 |
|
RC228873L3 | Lenti-ORF clone of STAU2 (Myc-DDK-tagged)-Human staufen, RNA binding protein, homolog 2 (Drosophila) (STAU2), transcript variant 4 |
CNY 5,890.00 |
|
RC228873L4 | Lenti-ORF clone of STAU2 (mGFP-tagged)-Human staufen, RNA binding protein, homolog 2 (Drosophila) (STAU2), transcript variant 4 |
CNY 5,890.00 |
|
RG228873 | STAU2 (tGFP-tagged) - Human staufen, RNA binding protein, homolog 2 (Drosophila) (STAU2), transcript variant 4 |
CNY 4,370.00 |