LENG4 (MBOAT7) (NM_001146056) Human Untagged Clone
CAT#: SC327511
MBOAT7 (untagged)-Human membrane bound O-acyltransferase domain containing 7 (MBOAT7) transcript variant 2
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BB1; hMBOA-7; LENG4; LPIAT; LPLAT; LRC4; MBOA7; MRT57; OACT7 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146056, the custom clone sequence may differ by one or more nucleotides
ATGGGGAGCAGCCGCTGTGGGCCTGGGGCTCACCCTGTTCACCTGTGGCCCCCACACTTT GCATTCTCTGGTCACCATCCTCGGGACCTGGGCCCTCATTCAGGCCCAGCCCTGCTGGTG AGCCTGGCCAGTGAAGTCCAGGACCTGCATCTGGCCCAGAGGAAGGAAATGGCCTCAGGC TTCAGCAAGGGGCCCACCCTGGGGCTGCTGCCCGACGTGCCCTCCCTGATGGAGACACTC AGCTACAGCTACTGCTACGTGGGAATCATGACAGGCCCGTTCTTCCGCTACCGCACCTAC CTGGACTGGCTGGAGCAGCCCTTCCCCGGGGCAGTGCCCAGCCTGCGGCCCCTGCTGCGC CGCGCCTGGCCGGCCCCGCTCTTCGGCCTGCTGTTCCTGCTCTCCTCTCACCTCTTCCCG CTGGAGGCCGTGCGCGAGGACGCCTTCTACGCCCGCCCGCTGCCCGCCCGCCTCTTCTAC ATGATCCCCGTCTTCTTCGCCTTCCGCATGCGCTTCTACGTGGCCTGGATTGCCGCCGAG TGCGGCTGCATTGCCGCCGGCTTTGGGGCCTACCCCGTGGCCGCCAAAGCCCGGGCCGGA GGCGGCCCCACCCTCCAATGCCCACCCCCCAGCAGTCCGGAGAAGGCGGCTTCCTTGGAG TATGACTATGAGACCATCCGCAACATCGACTGCTACAGCACAGATTTCTGCGTGCGGGTG CGCGATGGCATGCGGTACTGGAACATGACGGTGCAGTGGTGGCTGGCGCAGTATATCTAC AAGAGCGCACCTGCCCGTTCCTATGTCCTGCGGAGCGCCTGGACCATGCTGCTGAGCGCC TACTGGCACGGCCTCCACCCGGGCTACTACCTGAGCTTCCTGACCATCCCGCTGTGCCTG GCTGCCGAGGGCCGGCTGGAGTCAGCCCTGCGGGGGCGGCTGAGCCCAGGGGGCCAGAAG GCCTGGGACTGGGTGCACTGGTTCCTGAAGATGCGCGCCTATGACTACATGTGCATGGGC TTCGTGCTGCTCTCCTTGGCCGACACCCTTCGGTACTGGGCCTCCATCTACTTCTGTATC CACTTCCTGGCCCTGGCAGCCCTGGGGCTGGGGCTGGCTTTAGGTGGGGGCAGCCCCAGC CGGCGGAAGGCAGCATCCCAGCCCACCAGCCTTGCCCCAGAGAAGCTCCGGGAGGAG |
Restriction Sites | Please inquire |
ACCN | NM_001146056 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146056.1, NP_001139528.1 |
RefSeq Size | 2409 bp |
RefSeq ORF | 1200 bp |
Locus ID | 79143 |
UniProt ID | Q96N66 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. Both variants 2 and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228876 | MBOAT7 (Myc-DDK-tagged)-Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 2 |
CNY 3,990.00 |
|
RC228876L3 | Lenti-ORF clone of MBOAT7 (Myc-DDK-tagged)-Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 2 |
CNY 5,890.00 |
|
RC228876L4 | Lenti-ORF clone of MBOAT7 (mGFP-tagged)-Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 2 |
CNY 5,890.00 |
|
RG228876 | MBOAT7 (tGFP-tagged) - Human membrane bound O-acyltransferase domain containing 7 (MBOAT7), transcript variant 2 |
CNY 4,370.00 |