CHAC1 (NM_024111) Human Untagged Clone
CAT#: SC327770
CHAC1 (untagged)-Human ChaC cation transport regulator homolog 1 (E. coli) (CHAC1) transcript variant 1
CNY 5,872.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_024111, the custom clone sequence may differ by one or more nucleotides
ATGGGGGGCGCTCAGCTGGAGCTACCGAGCGGTGCCAGGCCAGGTGTGTGCGTCCGTCGGTCTTTCCGTG CCCACGCCGGAGACCAGCCCCGGAGGCCGCCTGGGCCTATCCCTGTGCCAGGCACCATGAAGCAGGAGTC TGCAGCCCCGAACACCCCGCCCACCTCGCAGTCCCCTACGCCGTCCGCTCAGTTCCCCCGAAACGACGGC GACCCTCAAGCGCTGTGGATTTTCGGGTACGGCTCCCTGGTGTGGAGGCCCGACTTCGCCTACAGCGACA GCCGTGTGGGCTTCGTGCGCGGCTACAGCCGCCGTTTCTGGCAGGGAGACACCTTCCATCGGGGCAGCGA CAAGATGCCTGGCCGTGTGGTGACGCTCCTTGAAGATCATGAGGGCTGCACTTGGGGCGTGGCATACCAA GTGCAAGGGGAGCAGGTAAGCAAGGCCCTGAAGTACCTGAATGTGCGAGAGGCAGTGCTTGGTGGCTACG ATACCAAGGAGGTCACCTTCTATCCCCAAGATGCTCCTGACCAACCACTGAAGGCATTGGCCTATGTGGC CACCCCACAGAACCCTGGTTACCTGGGCCCTGCGCCTGAAGAGGCCATTGCCACGCAGATCCTGGCCTGC CGGGGCTTCTCCGGCCACAACCTTGAATACTTGCTGCGTCTGGCAGACTTCATGCAGCTCTGTGGGCCTC AGGCGCAGGACGAGCACCTGGCAGCCATCGTGGACGCTGTGGGCACCATGTTGCCCTGCTTCTGCCCCAC CGAGCAGGCTCTGGCGCTGGTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_024111 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024111.3, NP_077016.2 |
RefSeq Size | 1578 bp |
RefSeq ORF | 1578 bp |
Locus ID | 79094 |
UniProt ID | Q9BUX1 |
Domains | ChaC |
Gene Summary | This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
CHAC1/MGC4504 Is a Novel Proapoptotic Component of the Unfolded Protein Response, Downstream of the ATF4-ATF3-CHOP Cascade
,Imran N. Mungrue, Joanne Pagnon, Omid Kohannim, Peter S. Gargalovic, and Aldons J. Lusis,
J. Immunol., Jan 2009; 182: 466 - 476.
[CHAC1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200912 | CHAC1 (Myc-DDK-tagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
CNY 3,600.00 |
|
RC200912L1 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC200912L2 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC200912L3 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200912L4 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC229135 | CHAC1 (Myc-DDK-tagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
CNY 3,600.00 |
|
RC229135L1 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC229135L3 | Lenti ORF clone of Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1, Myc-DDK-tagged |
CNY 6,840.00 |
|
RG200912 | CHAC1 (tGFP-tagged) - Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
CNY 5,200.00 |
|
RG229135 | CHAC1 (tGFP-tagged) - Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
CNY 5,420.00 |
|
SC111411 | CHAC1 (untagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 1 |
CNY 3,600.00 |