United States
Germany
Japan
United Kingdom
China
FOXA2 (NM_021784) Human Untagged Clone
CAT＃: SC327867
FOXA2 (untagged)-Human forkhead box A2 (FOXA2) transcript variant 1
CNY 5,488.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HNF-3-beta; HNF3B; TCF3B |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene ORF sequence for NM_021784 edited
ATGCACTCGGCTTCCAGTATGCTGGGAGCGGTGAAGATGGAAGGGCACGAGCCGTCCGAC TGGAGCAGCTACTATGCAGAGCCCGAGGGCTACTCCTCCGTGAGCAACATGAACGCCGGC CTGGGGATGAACGGCATGAACACGTACATGAGCATGTCGGCGGCCGCCATGGGCAGCGGC TCGGGCAACATGAGCGCGGGCTCCATGAACATGTCGTCGTACGTGGGCGCTGGCATGAGC CCGTCCCTGGCGGGGATGTCCCCCGGCGCGGGCGCCATGGCGGGCATGGGCGGCTCGGCC GGGGCGGCCGGCGTGGCGGGCATGGGGCCGCACTTGAGTCCCAGCCTGAGCCCGCTCGGG GGGCAGGCGGCCGGGGCCATGGGCGGCCTGGCCCCCTACGCCAACATGAACTCCATGAGC CCCATGTACGGGCAGGCGGGCCTGAGCCGCGCCCGCGACCCCAAGACCTACAGGCGCAGC TACACGCACGCAAAGCCGCCCTACTCGTACATCTCGCTCATCACCATGGCCATCCAGCAG AGCCCCAACAAGATGCTGACGCTGAGCGAGATCTACCAGTGGATCATGGACCTCTTCCCC TTCTACCGGCAGAACCAGCAGCGCTGGCAGAACTCCATCCGCCACTCGCTCTCCTTCAAC GACTGTTTCCTGAAGGTGCCCCGCTCGCCCGACAAGCCCGGCAAGGGCTCCTTCTGGACC CTGCACCCTGACTCGGGCAACATGTTCGAGAACGGCTGCTACCTGCGCCGCCAGAAGCGC TTCAAGTGCGAGAAGCAGCTGGCGCTGAAGGAGGCCGCAGGCGCCGCCGGCAGCGGCAAG AAGGCGGCCGCCGGAGCCCAGGCCTCACAGGCTCAACTCGGGGAGGCCGCCGGGCCGGCC TCCGAGACTCCGGCGGGCACCGAGTCGCCTCACTCGAGCGCCTCCCCGTGCCAGGAGCAC AAGCGAGGGGGCCTGGGAGAGCTGAAGGGGACGCCGGCTGCGGCGCTGAGCCCCCCAGAG CCGGCGCCCTCTCCCGGGCAGCAGCAGCAGGCCGCGGCCCACCTGCTGGGCCCGCCCCAC CACCCGGGCCTGCCGCCTGAGGCCCACCTGAAGCCGGAACACCACTACGCCTTCAACCAC CCGTTCTCCATCAACAACCTCATGTCCTCGGAGCAGCAGCACCACCACAGCCACCACCAC CACCAACCCCACAAAATGGACCTCAAGGCCTACGAACAGGTGATGCACTACCCCGGCTAC GGTTCCCCCATGCCTGGCAGCTTGGCCATGGGCCCGGTCACGAACAAAACGGGCCTGGAC GCCTCGCCCCTGGCCGCAGATACCTCCTACTACCAGGGGGTGTACTCCCGGCCCATTATG AACTCCTCTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_021784 |
| Insert Size | 2428 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021784.4. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021784.4, NP_068556.2 |
| RefSeq Size | 2428 bp |
| RefSeq ORF | 1392 bp |
| Locus ID | 3170 |
| UniProt ID | Q9Y261 |
| Protein Families | Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transcription Factors |
| Protein Pathways | Maturity onset diabetes of the young |
| Gene Summary | This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Transcription Factors and Medium Suitable for Initiating the Differentiation of Human Induced Pluripotent Stem Cells to the Hepatocyte Lineage
,Tomizawa, M;Shinozaki, F;Motoyoshi, Y;Sugiyama, T;Yamamoto, S;Ishige, N;,
J. Cell. Biochem.
,PubMed ID 26773721
[FOXA2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204066 | FOXA2 (Myc-DDK-tagged)-Human forkhead box A2 (FOXA2), transcript variant 1 |
CNY 5,488.00 |
|
| RC204066L1 | Lenti ORF clone of Human forkhead box A2 (FOXA2), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC204066L2 | Lenti ORF clone of Human forkhead box A2 (FOXA2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC204066L3 | Lenti ORF clone of Human forkhead box A2 (FOXA2), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC204066L4 | Lenti ORF clone of Human forkhead box A2 (FOXA2), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
| RG204066 | FOXA2 (tGFP-tagged) - Human forkhead box A2 (FOXA2), transcript variant 1 |
CNY 7,088.00 |
|
| SC122913 | FOXA2 (untagged)-Human forkhead box A2 (FOXA2), transcript variant 1 |
CNY 5,488.00 |
