APEG1 (SPEG) (NM_001173476) Human Untagged Clone
CAT#: SC328181
SPEG (untagged)-Human SPEG complex locus (SPEG) transcript variant 4
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APEG-1; APEG1; BPEG; CNM5; MYLK6; SPEGalpha; SPEGbeta |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001173476, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCCAGTCCCAGCCAGAACCGCCGTTCTTCTGACACTGGCTCCAAGGCACCCCCC ACCTTCAAGGTCTCACTTATGGACCAGTCAGTAAGAGAAGGCCAAGATGTCATCATGAGC ATCCGCGTGCAGGGGGAGCCCAAGCCTGTGGTCTCCTGGCTGAGAAACCGCCAGCCCGTG CGCCCAGACCAGCGGCGCTTTGCGGAGGAGGCTGAGGGTGGGCTGTGCCGGCTGCGGATC CTGGCTGCAGAGCGTGGCGATGCTGGTTTCTACACTTGCAAAGCGGTCAATGAGTATGGT GCTCGGCAGTGCGAGGCCCGCTTGGAGGTCCGAGGCGAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001173476 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001173476.1, NP_001166947.1 |
RefSeq Size | 1449 bp |
RefSeq ORF | 342 bp |
Locus ID | 10290 |
UniProt ID | Q15772 |
Gene Summary | This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Along with the desmin gene, expression of this gene may be controlled by the desmin locus control region. Mutations in this gene are associated with centronuclear myopathy 5. [provided by RefSeq, Jun 2016] Transcript Variant: This variant (4) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant 1. The encoded protein (isoform 4) is shorter than isoform 1. This variant corresponds to the mouse APEG-1 variant described in PubMed ID: 10973969. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229543 | SPEG (Myc-DDK-tagged)-Human SPEG complex locus (SPEG), transcript variant 4 |
CNY 3,990.00 |
|
RC229543L3 | Lenti-ORF clone of SPEG (Myc-DDK-tagged)-Human SPEG complex locus (SPEG), transcript variant 4 |
CNY 5,890.00 |
|
RC229543L4 | Lenti-ORF clone of SPEG (mGFP-tagged)-Human SPEG complex locus (SPEG), transcript variant 4 |
CNY 5,890.00 |
|
RG229543 | SPEG (tGFP-tagged) - Human SPEG complex locus (SPEG), transcript variant 4 |
CNY 4,370.00 |