FCRLM1 (FCRLA) (NM_001184871) Human Untagged Clone
CAT#: SC328214
FCRLA (untagged)-Human Fc receptor-like A (FCRLA) transcript variant 7
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FCRL; FCRL1; FCRLb; FCRLc1; FCRLc2; FCRLd; FCRLe; FCRLM1; FCRLX; FCRX; FREB |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184871, the custom clone sequence may differ by one or more nucleotides
ATGTTGAAGAAAATCAGTGTTGGGGTTGCAGGAGACCTAAACACAGTCACCATGAAGCTG GGCTGTGTCCTCATGGCCTGGGCCCTCTACCTTTCCCTTGGTGTGCTCTGGGTGGCCCAG ATGCTACTGGGTGCTTCCAGCTCTGCTGCACCTCCCACATTGAATCCAGCTCCTCAGAAA TCAGCTGCTCCAGGAACTGCTCCTGAGGAGGCCCCTGGGCCTCTGCCTCCGCCGCCAACC CCATCTTCTGAGGATCCAGGCTTTTCTTCTCCTCTGGGGATGCCAGATCCTCATCTGTAT CACCAGATGGGCCTTCTTCTCAAACACATGCAGGATGTGAGAGTCCTCCTCGGTCACCTG CTCATGGAGTTGAGGGAATTATCTGGCCACCGGAAGCCTGGGACCACAAAGGCTACTGCT GAATAG |
Restriction Sites | Please inquire |
ACCN | NM_001184871 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184871.1, NP_001171800.1 |
RefSeq Size | 1652 bp |
RefSeq ORF | 426 bp |
Locus ID | 84824 |
UniProt ID | Q7L513 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a protein similar to receptors for the Fc fragment of gamma immunoglobulin (IgG). These receptors, referred to as FCGRs, mediate the destruction of IgG-coated antigens and of cells induced by antibodies. This encoded protein is selectively expressed in B cells, and may be involved in their development. This protein may also be involved in the development of lymphomas. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (7) lacks four alternate, in-frame segments, compared to variant 1. The resulting protein (isoform 7) is shorter when it is compared to isoform 1. This variant has also been called FCRLe. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229576 | FCRLA (Myc-DDK-tagged)-Human Fc receptor-like A (FCRLA), transcript variant 7 |
CNY 3,990.00 |
|
RC229576L3 | Lenti-ORF clone of FCRLA (Myc-DDK-tagged)-Human Fc receptor-like A (FCRLA), transcript variant 7 |
CNY 5,890.00 |
|
RC229576L4 | Lenti-ORF clone of FCRLA (mGFP-tagged)-Human Fc receptor-like A (FCRLA), transcript variant 7 |
CNY 5,890.00 |
|
RG229576 | FCRLA (tGFP-tagged) - Human Fc receptor-like A (FCRLA), transcript variant 7 |
CNY 4,370.00 |