MDFIC (NM_001166346) Human Untagged Clone
CAT#: SC328234
MDFIC (untagged)-Human MyoD family inhibitor domain containing (MDFIC) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HIC; MDFIC1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166346, the custom clone sequence may differ by one or more nucleotides
GTGCGCGGAGTCAGAGCCGCCACCGCTGCCGCAGTTGCCGCCACTGCGGCGTCTGGGCTG AGCCGGAGGGAGGCGGGAGGACGCGCAGGGGCGGCCGCCGCCGTCGTCAGGCCACCGGGG CGAAAATGCGGCCGCTGCCGGAGGCTCGCTAACTTTCCGGGGCGGAAGAGGAGGAGGAGG AGGAGGAAGGGGCTTGGAGCGACTACGGGGGGATGCGGAGAAGCAGTCAGTTCCCTGCAC CCAGCACCTCACAGCCCTTCCTCCGTGCGCCCTGCCGGGCGGCGAGCTAGGCGGCAGCGG CGCGGCGCGGGCTCGGCGGAGCGGCCCATGTCCGGCGCGGGCGAAGCCCTCGCTCCCGGG CCCGTGGGGCCGCAGCGCGTGGCCGAGGCGGGCGGCGGCCAGCTGGGCTCCACAGCCCAG GGTCTCTTCAGCAGATCCAGGACTGCCGCAGCTCTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001166346 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001166346.1, NP_001159818.3 |
RefSeq Size | 891 bp |
RefSeq ORF | 459 bp |
Locus ID | 29969 |
Gene Summary | This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, p40 and p32, respectively, which have different subcellular localization; p32 is mainly found in the cytoplasm, whereas p40 is targeted to the nucleolus. Both isoforms have transcriptional regulatory activity that is attributable to the cysteine-rich C-terminal domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct and shorter C-terminus, compared to isoform p40. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229596 | MDFIC (Myc-DDK-tagged)-Human MyoD family inhibitor domain containing (MDFIC), transcript variant 2 |
CNY 3,990.00 |
|
RC229596L3 | Lenti-ORF clone of MDFIC (Myc-DDK-tagged)-Human MyoD family inhibitor domain containing (MDFIC), transcript variant 2 |
CNY 5,890.00 |
|
RC229596L4 | Lenti-ORF clone of MDFIC (mGFP-tagged)-Human MyoD family inhibitor domain containing (MDFIC), transcript variant 2 |
CNY 5,890.00 |
|
RG229596 | MDFIC (tGFP-tagged) - Human MyoD family inhibitor domain containing (MDFIC), transcript variant 2 |
CNY 4,370.00 |