GM2A (NM_001167607) Human Untagged Clone
CAT#: SC328285
GM2A (untagged)-Human GM2 ganglioside activator (GM2A) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GM2-AP; SAP-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328285 representing NM_001167607.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGTCCCTGATGCAGGCTCCCCTCCTGATCGCCCTGGGCTTGCTTCTCGCGGCCCCTGCGCAAGCC CACCTGAAAAAGCCATCCCAGCTCAGTAGCTTTTCCTGGGATAACTGTGATGAAGGGAAGGACCCTGCG GTGATCAGAAGCCTGACTCTGGAGCCTGACCCCATCATCGTTCCTGGAAATGTGACCCTCAGTGTCATG GGCAGCACCAGTGTCCCCCTGAGTTCTCCTCTGAAGGTGGATTTAGTTTTGGAGAAGGAGGTGGCTGGC CTCTGGATCAAGATCCCATGCACAGACTACATTGGCAGCTGTACCTTTGAACACTTCTGTGATGTGCTT GACATGTTAATTCCTACTGGGGAGCCCTGCCCAGAGCCCCTGCGTACCTATGGGCTTCCTTGCCACTGT CCCTTTTCCTCTGTTTTGTGTTTGCCAAGGCCAAACTCCCACTCTCTGCCCCCCTTTAATCCCCTTTCT ACAGTGAGTCCACTACCCTCACTGAAAATCATTTTGTACCACTTACATTTTAGGCTGGGGCAAGCAGCC CTGACCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001167607 |
Insert Size | 561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001167607.1 |
RefSeq Size | 3480 bp |
RefSeq ORF | 561 bp |
Locus ID | 2760 |
Protein Families | Druggable Genome |
Protein Pathways | Lysosome |
MW | 20.1 kDa |
Gene Summary | This gene encodes a small glycolipid transport protein which acts as a substrate specific co-factor for the lysosomal enzyme beta-hexosaminidase A. Beta-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mutations in this gene result in GM2-gangliosidosis type AB or the AB variant of Tay-Sachs disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229647 | GM2A (Myc-DDK-tagged)-Human GM2 ganglioside activator (GM2A), transcript variant 2 |
CNY 2,400.00 |
|
RC229647L3 | Lenti ORF clone of Human GM2 ganglioside activator (GM2A), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC229647L4 | Lenti ORF clone of Human GM2 ganglioside activator (GM2A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG229647 | GM2A (tGFP-tagged) - Human GM2 ganglioside activator (GM2A), transcript variant 2 |
CNY 4,370.00 |