GM2A (NM_001167607) Human Untagged Clone

CAT#: SC328285

GM2A (untagged)-Human GM2 ganglioside activator (GM2A) transcript variant 2



  "NM_001167607" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GM2A rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GM2-AP; SAP-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328285 representing NM_001167607.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGTCCCTGATGCAGGCTCCCCTCCTGATCGCCCTGGGCTTGCTTCTCGCGGCCCCTGCGCAAGCC
CACCTGAAAAAGCCATCCCAGCTCAGTAGCTTTTCCTGGGATAACTGTGATGAAGGGAAGGACCCTGCG
GTGATCAGAAGCCTGACTCTGGAGCCTGACCCCATCATCGTTCCTGGAAATGTGACCCTCAGTGTCATG
GGCAGCACCAGTGTCCCCCTGAGTTCTCCTCTGAAGGTGGATTTAGTTTTGGAGAAGGAGGTGGCTGGC
CTCTGGATCAAGATCCCATGCACAGACTACATTGGCAGCTGTACCTTTGAACACTTCTGTGATGTGCTT
GACATGTTAATTCCTACTGGGGAGCCCTGCCCAGAGCCCCTGCGTACCTATGGGCTTCCTTGCCACTGT
CCCTTTTCCTCTGTTTTGTGTTTGCCAAGGCCAAACTCCCACTCTCTGCCCCCCTTTAATCCCCTTTCT
ACAGTGAGTCCACTACCCTCACTGAAAATCATTTTGTACCACTTACATTTTAGGCTGGGGCAAGCAGCC
CTGACCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001167607
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001167607.1
RefSeq Size 3480 bp
RefSeq ORF 561 bp
Locus ID 2760
Protein Families Druggable Genome
Protein Pathways Lysosome
MW 20.1 kDa
Gene Summary This gene encodes a small glycolipid transport protein which acts as a substrate specific co-factor for the lysosomal enzyme beta-hexosaminidase A. Beta-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mutations in this gene result in GM2-gangliosidosis type AB or the AB variant of Tay-Sachs disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...