United States
Germany
Japan
United Kingdom
China
SFTPC (NM_001172357) Human Untagged Clone
CAT＃: SC328299
SFTPC (untagged)-Human surfactant protein C (SFTPC) transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BRICD6; PSP-C; SFTP2; SMDP2; SP-C; SP5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328299 representing NM_001172357.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATGTGGGCAGCAAAGAGGTCCTGATGGAGAGCCCGCCGGACTACTCCGCAGCTCCCCGGGGCCGA TTTGGCATTCCCTGCTGCCCAGTGCACCTGAAACGCCTTCTTATCGTGGTGGTGGTGGTGGTCCTCATC GTCGTGGTGATTGTGGGAGCCCTGCTCATGGGTCTCCACATGAGCCAGAAACACACGGAGATGGTTCTG GAGATGAGCATTGGGGCGCCGGAAGCCCAGCAACGCCTGGCCCTGAGTGAGCACCTGGTTACCACTGCC ACCTTCTCCATCGGCTCCACTGGCCTCGTGGTGTATGACTACCAGCAGCTGCTGATCGCCTACAAGCCA GCCCCTGGCACCTGCTGCTACATCATGAAGATAGCTCCAGAGAGCATCCCCAGTCTTGAGGCTCTCACT AGAAAAGTCCACAACTTCCAGGCCAAGCCCGCAGTGCCTACGTCTAAGCTGGGCCAGGCAGAGGGGCGA GATGCAGGCTCAGCACCCTCCGGAGGGGACCCGGCCTTCCTGGGCATGGCCGTGAGCACCCTGTGTGGC GAGGTGCCGCTCTACTACATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001172357 |
| Insert Size | 576 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001172357.1 |
| RefSeq Size | 1187 bp |
| RefSeq ORF | 576 bp |
| Locus ID | 6440 |
| UniProt ID | P11686 |
| Protein Families | Secreted Protein, Transmembrane |
| MW | 20.3 kDa |
| Gene Summary | This gene encodes the pulmonary-associated surfactant protein C (SPC), an extremely hydrophobic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 2, also called pulmonary alveolar proteinosis due to surfactant protein C deficiency, and are associated with interstitial lung disease in older infants, children, and adults. Alternatively spliced transcript variants encoding different protein isoforms have been identified.[provided by RefSeq, Feb 2010] Transcript Variant: This variant (3) lacks an in-frame segment in the 3' coding region and has an additional segment in the 3' UTR, as compared to variant 1. The transcript is longer than variant 1, but encodes a shorter isoform (2), as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229661 | SFTPC (Myc-DDK-tagged)-Human surfactant protein C (SFTPC), transcript variant 3 |
CNY 2,400.00 |
|
| RC229661L3 | Lenti ORF clone of Human surfactant protein C (SFTPC), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC229661L4 | Lenti ORF clone of Human surfactant protein C (SFTPC), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG229661 | SFTPC (tGFP-tagged) - Human surfactant protein C (SFTPC), transcript variant 3 |
CNY 4,370.00 |
