ASTN2 (NM_001184735) Human Untagged Clone
CAT#: SC328307
ASTN2 (untagged)-Human astrotactin 2 (ASTN2) transcript variant 6
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA67K19.1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184735, the custom clone sequence may differ by one or more nucleotides
ATGCCCTTCATCACCTACCTCTCAGGTTTGCTGACAGCCCAGATGCTGTCAGATGACCAG CTCATTTCAGGTGTGGAGATTCGCTGTGAGGAGAAGGGGCGCTGTCCATCTACCTGTCAC CTTTGCCGCCGGCCAGGCAAGGAGCAGCTGAGCCCCACACCAGTGCTGCTGGAAATCAAC CGTGTGGTGCCACTTTATACCCTCATCCAAGACAATGGCACAAAGGAGGCCTTCAAGAGT GCACTGATGAGTTCCTACTGGTGCTCAGGGAAAGGGGATGTGATCGATGACTGGTGCAGG TGTGACCTCAGCGCCTTTGATGCCAATGGGCTCCCCAACTGCAGCCCCCTTCTGCAGCCG GTGCTGCGGCTGTCCCCAACAGTGGAGCCCTCCAGTACTGTGGTCTCCTTGGAGTGGGTG GATGTTCAGCCAGCTATTGGGACCAAGGTCTCCGACTATATTCTGCAGCATAAGAAAGTG GATGAATACACAGACACTGACCTGTACACAGTTTATTGCTGGATTACATTTATTGATTTG CGGATATTGAACCAGCCTTGCATCCCAGGGATGAAGCCAACTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001184735 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184735.1, NP_001171664.1 |
RefSeq Size | 3519 bp |
RefSeq ORF | 585 bp |
Locus ID | 23245 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010] Transcript Variant: This variant (6) has multiple differences compared to variant 1. These differences result in a distinct 5' UTR and lead to translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (f) has distinct N- and C-termini and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229669 | ASTN2 (Myc-DDK-tagged)-Human astrotactin 2 (ASTN2), transcript variant 6 |
CNY 3,990.00 |
|
RC229669L3 | Lenti-ORF clone of ASTN2 (Myc-DDK-tagged)-Human astrotactin 2 (ASTN2), transcript variant 6 |
CNY 5,890.00 |
|
RC229669L4 | Lenti-ORF clone of ASTN2 (mGFP-tagged)-Human astrotactin 2 (ASTN2), transcript variant 6 |
CNY 5,890.00 |
|
RG229669 | ASTN2 (tGFP-tagged) - Human astrotactin 2 (ASTN2), transcript variant 6 |
CNY 4,370.00 |