Endothelin 1 (EDN1) (NM_001168319) Human Untagged Clone
CAT#: SC328328
EDN1 (untagged)-Human endothelin 1 (EDN1) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARCND3; ET1; HDLCQ7; PPET1; QME |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328328 representing NM_001168319.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATTATTTGCTCATGATTTTCTCTCTGCTGTTTGTGGCTTGCCAAGGAGCTCCAGAAACAGTCTTA GGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTC CGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGAC ATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCC TTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGAC AAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGG AATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGA GGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGACCATGAGAAACAGC GTCAAATCATCTTTTCATGATCCCAAGCTGAAAGGCAAGCCCTCCAGAGAGCGTTATGTGACCCACAAC CGAGCACATTGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001168319 |
Insert Size | 636 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001168319.1 |
RefSeq Size | 2109 bp |
RefSeq ORF | 636 bp |
Locus ID | 1906 |
UniProt ID | P05305 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Melanogenesis |
MW | 24.4 kDa |
Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate a secreted peptide that belongs to the endothelin/sarafotoxin family. This peptide is a potent vasoconstrictor and its cognate receptors are therapeutic targets in the treatment of pulmonary arterial hypertension. Aberrant expression of this gene may promote tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (2) uses an alternate in-frame splice site at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is 1 aa shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229690 | EDN1 (Myc-DDK-tagged)-Human endothelin 1 (EDN1), transcript variant 2 |
CNY 2,400.00 |
|
RC229690L3 | Lenti ORF clone of Human endothelin 1 (EDN1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229690L4 | Lenti ORF clone of Human endothelin 1 (EDN1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG229690 | EDN1 (tGFP-tagged) - Human endothelin 1 (EDN1), transcript variant 2 |
CNY 4,370.00 |
其它Endothelin 1产品