SENP8 (NM_001172110) Human Untagged Clone

CAT#: SC328333

SENP8 (untagged)-Human SUMO/sentrin specific peptidase family member 8 (SENP8) transcript variant 4



  "NM_001172110" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SENP8 mouse monoclonal antibody, clone OTI3E4 (formerly 3E4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DEN1; NEDP1; PRSC2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172110, the custom clone sequence may differ by one or more nucleotides
ATGGACCCCGTAGTCTTGAGTTACATGGACAGTCTACTGCGGCAATCAGATGTCTCACTA
TTGGATCCGCCAAGCTGGCTCAATGACCATATTATTGGGTTTGCGTTTGAGTACTTTGCC
AACAGTCAGTTTCATGACTGCTCTGATCACGTCAGTTTCATCAGCCCTGAAGTCACCCAG
TTCATCAAGTGCACTAGCAACCCAGCAGAGATTGCCATGTTCCTTGAACCACTGGACCTC
CCCAACAAGAGAGTTGTATTTTTAGCCATCAATGATAACTCCAACCAGGCAGCTGGAGGA
ACCCACTGGAGTTTATTGGTCTACCTCCAAGATAAAAATAGCTTTTTTCATTATGATTCC
CATAGCAGGAGCAACTCAGTTCACGCAAAGCAGGTAGCAGAGAAACTGGAGGCTTTCTTA
GGCAGAAAAGGAGACAAACTGGCCTTTGTGGAAGAGAAAGCCCCTGCCCAACAAAACAGC
TATGACTGTGGGATGTACGTGATATGTAACACTGAGGCCTTGTGTCAGAACTTCTTTAGG
CAACAGACAGAATCACTGCTGCAGCTACTCACCCCTGCATACATCACAAAGAAGAGGGGA
GAATGGAAAGATCTCATTACCACACTTGCTAAAAAGTAG
Restriction Sites Please inquire     
ACCN NM_001172110
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001172110.1, NP_001165581.1
RefSeq Size 1676 bp
RefSeq ORF 639 bp
Locus ID 123228
UniProt ID Q96LD8
Protein Families Druggable Genome, Protease
Gene Summary This gene encodes a cysteine protease that is a member of the sentrin-specific protease family. The encoded protein is involved in processing and deconjugation of the ubiquitin-like protein termed, neural precursor cell expressed developmentally downregulated 8. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4 and 5 encode the same protein. An in-frame AUG is located 44 codons upstream of the annotated translation start site but is not being annotated as a start site since it is not conserved and is in a weak Kozak sequence context. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...