Claudin 2 (CLDN2) (NM_001171095) Human Untagged Clone
CAT#: SC328367
CLDN2 (untagged)-Human claudin 2 (CLDN2) transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OAZON |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171095, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCTCTTGGCCTCCAACTTGTGGGCTACATCCTAGGCCTTCTGGGGCTTTTGGGC ACACTGGTTGCCATGCTGCTCCCCAGCTGGAAAACAAGTTCTTATGTCGGTGCCAGCATT GTGACAGCAGTTGGCTTCTCCAAGGGCCTCTGGATGGAATGTGCCACACACAGCACAGGC ATCACCCAGTGTGACATCTATAGCACCCTTCTGGGCCTGCCCGCTGACATCCAGGCTGCC CAGGCCATGATGGTGACATCCAGTGCAATCTCCTCCCTGGCCTGCATTATCTCTGTGGTG GGCATGAGATGCACAGTCTTCTGCCAGGAATCCCGAGCCAAAGACAGAGTGGCGGTAGCA GGTGGAGTCTTTTTCATCCTTGGAGGCCTCCTGGGATTCATTCCTGTTGCCTGGAATCTT CATGGGATCCTACGGGACTTCTACTCACCACTGGTGCCTGACAGCATGAAATTTGAGATT GGAGAGGCTCTTTACTTGGGCATTATTTCTTCCCTGTTCTCCCTGATAGCTGGAATCATC CTCTGCTTTTCCTGCTCATCCCAGAGAAATCGCTCCAACTACTACGATGCCTACCAAGCC CAACCTCTTGCCACAAGGAGCTCTCCAAGGCCTGGTCAACCTCCCAAAGTCAAGAGTGAG TTCAATTCCTACAGCCTGACAGGGTATGTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001171095 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001171095.1, NP_001164566.1 |
RefSeq Size | 2932 bp |
RefSeq ORF | 693 bp |
Locus ID | 9075 |
UniProt ID | P57739 |
Protein Families | Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
Gene Summary | This gene product belongs to the claudin protein family whose members have been identified as major integral membrane proteins localized exclusively at tight junctions. Claudins are expressed in an organ-specific manner and regulate tissue-specific physiologic properties of tight junctions. This protein is expressed in the intestine. Alternatively spliced transcript variants with different 5' untranslated region have been found for this gene.[provided by RefSeq, Jan 2010] Transcript Variant: This variant (3) uses an alternate 5' non-coding exon compared to variant 1. Variants 1-3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229729 | CLDN2 (Myc-DDK-tagged)-Human claudin 2 (CLDN2), transcript variant 3 |
CNY 2,400.00 |
|
RC229729L3 | Lenti-ORF clone of CLDN2 (Myc-DDK-tagged)-Human claudin 2 (CLDN2), transcript variant 3 |
CNY 5,890.00 |
|
RC229729L4 | Lenti-ORF clone of CLDN2 (mGFP-tagged)-Human claudin 2 (CLDN2), transcript variant 3 |
CNY 5,890.00 |
|
RG229729 | CLDN2 (tGFP-tagged) - Human claudin 2 (CLDN2), transcript variant 3 |
CNY 4,370.00 |