PEX11B (NM_001184795) Human Untagged Clone

CAT#: SC328395

PEX11B (untagged)-Human peroxisomal biogenesis factor 11 beta (PEX11B) transcript variant 2



  "NM_001184795" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-PEX11B antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PEX11-BETA; PEX14B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328395 representing NM_001184795.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAAACTGAGGGCCGCCCAGTATGCTTGCTCTCTTCTTGGCCATGCGCTGCAGAGGCATGGAGCC
AGTCCTGAGTTACAGAAACAGATTCGACAACTGGAGAGCCACCTGAGCCTTGGAAGAAAGCTTCTACGC
CTGGGTAACTCAGCAGATGCCCTTGAGTCAGCCAAAAGAGCTGTTCACCTATCAGATGTTGTCCTGAGA
TTCTGCATCACTGTTAGTCACCTCAATCGAGCCTTGTACTTCGCCTGTGACAATGTCCTGTGGGCTGGA
AAGTCTGGACTGGCTCCCCGTGTGGATCAGGAGAAGTGGGCCCAGCGTTCATTCAGGTACTATTTGTTT
TCCCTCATCATGAATTTGAGCCGTGATGCTTATGAGATTCGCCTACTGATGGAGCAAGAGTCTTCTGCT
TGTAGCCGGCGACTGAAAGGTTCTGGAGGAGGAGTCCCAGGAGGAAGTGAAACTGGGGGACTTGGGGGA
CCAGGGACTCCAGGAGGAGGTCTGCCCCAACTGGCTCTGAAACTTCGGCTGCAAGTCCTGCTCCTGGCT
CGAGTCCTTAGAGGTCATCCCCCACTTCTGCTAGACGTGGTCAGAAATGCCTGTGATCTCTTCATTCCT
CTGGACAAACTAGGCCTCTGGCGCTGTGGCCCTGGGATTGTGGGGCTTTGTGGCCTCGTGTCCTCCATC
CTGTCTATTCTCACCCTAATCTATCCCTGGCTACGACTCAAGCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001184795
Insert Size 738 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001184795.1
RefSeq Size 1642 bp
RefSeq ORF 738 bp
Locus ID 8799
UniProt ID O96011
Protein Families Transmembrane
MW 26.7 kDa
Gene Summary The protein encoded by this gene facilitates peroxisomal proliferation and interacts with PEX19. The encoded protein is found in the peroxisomal membrane. Several transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...