PGAM5 (NM_001170543) Human Untagged Clone
CAT#: SC328478
PGAM5 (untagged)-Human phosphoglycerate mutase family member 5 (PGAM5) nuclear gene encoding mitochondrial protein transcript variant 1
CNY 3,600.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BXLBV68 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001170543, the custom clone sequence may differ by one or more nucleotides
ATGGCGTTCCGGCAGGCGCTGCAGCTGGCGGCCTGCGGGCTGGCCGGGGGCTCGGCCGCCGTGCTCTTCT CGGCCGTGGCGGTAGGGAAGCCGCGCGCAGGCGGGGACGCGGAGCCACGCCCGGCTGAGCCGCCGGCCTG GGCGGGGGGCGCGCGGCCGGGCCCCGGTGTCTGGGACCCCAACTGGGACAGGCGAGAACCACTGTCTCTG ATCAACGTGCGGAAGAGGAACGTGGAATCTGGGGAAGAAGAGCTGGCGTCCAAGCTGGACCACTACAAAG CCAAGGCCACGCGGCACATCTTCCTCATCAGGCATTCCCAGTACCACGTGGATGGCTCCCTGGAGAAGGA CCGCACTCTGACCCCGCTGGGTCGGGAGCAGGCTGAACTCACTGGGCTCCGCCTGGCAAGCTTGGGGTTG AAGTTTAATAAAATCGTCCATTCGTCTATGACGCGCGCCATAGAGACCACCGATATCATCAGCCGGCACC TGCCAGGCGTCTGCAAAGTCAGCACAGATCTGCTGCGGGAAGGCGCCCCCATCGAGCCAGACCCGCCCGT GTCTCATTGGAAGCCGGAAGCTGTGCAGTATTACGAAGACGGAGCCCGGATCGAGGCCGCCTTCCGGAAC TACATCCACCGCGCAGATGCCAGGCAGGAGGAGGACAGTTACGAGATCTTCATCTGTCACGCCAACGTCA TCCGCTACATCGTGTGCAGAGCACTGCAGTTTCCTCCTGAAGGCTGGCTCCGGCTCTCCCTCAATAATGG CAGCATCACCCACCTGGTGATCCGACCCAACGGCCGAGTTGCGCTCAGGACCCTCGGGGACACGGGGTTC ATGCCTCCCGACAAGATCACTCGATCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001170543 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001170543.1, NP_001164014.1 |
RefSeq Size | 2851 bp |
RefSeq ORF | 870 bp |
Locus ID | 192111 |
UniProt ID | Q96HS1 |
Protein Families | Transmembrane |
Gene Summary | Displays phosphatase activity for serine/threonine residues, and, dephosphorylates and activates MAP3K5 kinase. Has apparently no phosphoglycerate mutase activity. May be regulator of mitochondrial dynamics. Substrate for a KEAP1-dependent ubiquitin ligase complex. Contributes to the repression of NFE2L2-dependent gene expression. Acts as a central mediator for programmed necrosis induced by TNF, by reactive oxygen species and by calcium ionophore.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Inhibitor of Nrf2 (INrf2 or Keap1) Protein Degrades Bcl-xL via Phosphoglycerate Mutase 5 and Controls Cellular Apoptosis
,Suryakant K. Niture and Anil K. Jaiswal,
J. Biol. Chem., Dec 2011; 286: 44542 - 44556.
[PGAM5]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229840 | PGAM5 (Myc-DDK-tagged)-Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3,600.00 |
|
RC229840L1 | Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC229840L2 | Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC229840L3 | Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229840L4 | Lenti ORF clone of Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RG229840 | PGAM5 (tGFP-tagged) - Human phosphoglycerate mutase family member 5 (PGAM5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,200.00 |