Manic Fringe (MFNG) (NM_001166343) Human Untagged Clone

CAT#: SC328498

MFNG (untagged)-Human MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (MFNG) transcript variant 2



  "NM_001166343" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-MFNG antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328498 representing NM_001166343.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGTGCCGGCTCCCGCGGGGCCTGGCTGGAGCCCTCCTCACCCTCCTGTGCATGGGGCTCCTGTGT
CTGCGGTACCACTTGAACCTGTCCCCGCAGCGGGTACAAGGGACCCCCGAGCTGAGCCAGCCGAACCCG
GGGCCCCCTAAGCTACAGCTACACGATGTCTTCATTGCAGTGAAGACGACCCGGGCTTTCCACCGCTTG
CGCCTGGAGCTGCTGCTTGACACGTGGGTTTCCAGGACCAGGGAACAGGTGACAAGGTCCCACCTTGTG
GTCACCAACTGCTCCGCGGAACACAGCCACCCAGCTCTGTCCTGCAAGATGGCTGCTGAGTTCGACACC
TTCTTGGCCAGTGGGCTTAGGTGGTTCTGCCATGTGGACGATGACAACTATGTGAACCCAAGGGCGCTG
CTGCAGCTTCTGAGAGCCTTCCCGCTGGCCCGCGACGTCTATGTGGGAAGGCCCAGCCTGAACCGGCCC
ATCCATGCCTCAGAGCCACAGCCCCACAACCGCACGAGGCTGGTACAGTTCTGGTTTGCCACTGGGGGT
GCTGGCTTCTGCATCAATCGCAAACTGGCTTTGAAGATGGCTCCGTGGGCCAGTGGCTCCCGTTTCATG
GACACATCTGCTCTCATCCGGCTGCCTGATGACTGCACCATGGGCTATATCATTGAGTGCAAGCTGGGC
GGCCGCCTGCAGCCCAGCCCCCTCTTTCACTCCCACCTGGAGACCCTGCAGCTGCTGAGGACTGCACAG
CTCCCAGAACAGGTCACCCTCAGCTACGGTGTCTTTGAGGGGAAACTCAACGTCATTAAGCTACAGGGC
CCCTTCTCCCCGGAGGAGGACCCCTCCAGATTTCGCTCCCTCCATTGTCTGCTCTATCCAGATACACCC
TGGTGTCCCCAGCTGGGTGCCCGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166343
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166343.1
RefSeq Size 2034 bp
RefSeq ORF 924 bp
Locus ID 4242
UniProt ID O00587
Protein Families Druggable Genome
Protein Pathways Notch signaling pathway
MW 34.7 kDa
Gene Summary This gene is a member of the glycosyltransferase 31 gene family. Members of this gene family, which also includes the LFNG (GeneID: 3955) and RFNG (GeneID: 5986) genes, encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, these proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. The protein encoded by this gene may control Notch signaling in claudin-low breast cancer. [provided by RefSeq, May 2018]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' exon and lacks an alternate 5' coding exon, compared to variant 1, resulting in a protein that maintains the reading frame but is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...