ZNF185 (NM_001178115) Human Untagged Clone

CAT#: SC328531

ZNF185 (untagged)-Human zinc finger protein 185 (LIM domain) (ZNF185) transcript variant 9



  "NM_001178115" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ZNF185 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SCELL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001178115, the custom clone sequence may differ by one or more nucleotides
ATGGCCGCCCGGGACGAGCTCGGCCTCGGCGGGGATTCTCTTGAGGCCATGCCCGTGCCG
GCCGCCAGAGGTCGCCCGAGGATCACGAATGGGCCCGAGGAGCTGGCTGCCCCTTCCCCC
GCGGCCTTGGCTGATTATGAGGGGAAGGATGTGGCCACCAGGGTCGGAGAGGCCTGGCAG
GAGAGGCCTGGAGCTCCAAGAGGTGGCCAAGGAGACCCAGCTGTACCCGCTCAGCAACCT
GCAGATCCCAGCACCCCAGAGCGGCAGAGCAGCCCCAGCGGATCTGAGCAACTTGTCAGA
CGAGAGAGTTGTGGCAGCAGCGTGTTGACTGATTTTGAGGGGAAGGATGTGGCCACCAAG
GTCGGAGAGGCCTGGCAGGACAGGCCTGGAGCCCCAAGAGGTGGCCAAGGAGACCCAGCT
GTACCCACTCAGCAACCTGCAGATCCCAGTACCCCAGAACAGCAGAACAGCCCCAGCGGA
TCTGAGCAATTCGTCAGACGAGAGAGCTGCACCAGCAGGGTGAGGAGCCCCTCGAGCTGC
ATGGTCACTGTTACTGTCACTGCCACATCTGAGCAGCCTCACATTTATATTCCAGCCCCC
GCAAGTGAATTGGACTCCAGCTCTACCACCAAAGGGATTCTCTTCGTGAAGGAGTACGTG
AATGCTAGTGAAGTGTCTTCTGGGAAGCCAGTATCTGCACGCTATAGCAACGTCAGCAGC
ATTGAGGACTCATTCGCCATGGAGAAGAAGCCTCCATGTGGCAGCACTCCATACTCTGAG
AGGACAACTGGAGGGATCTGTACTTACTGCAACCGTGAGATCCGAGACTGTCCAAAGATT
ACCCTAGAACATCTTGGTATCTGCTGCCATGAATATTGCTTTAAGTGTGGGATTTGCAGT
AAACCGATGGGCGATCTCCTGGATCAGATCTTCATTCACCGTGACACCATTCACTGTGGG
AAATGCTATGAGAAGCTCTTCTAG
Restriction Sites Please inquire     
ACCN NM_001178115
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001178115.1, NP_001171586.1
RefSeq Size 3248 bp
RefSeq ORF 984 bp
Locus ID 7739
UniProt ID O15231
Gene Summary Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a LIM-domain zinc finger protein. The LIM domain is composed of two contiguous zinc finger domains, separated by a two-amino acid residue hydrophobic linker. The LIM domain mediates protein:protein interactions. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, May 2010]
Transcript Variant: This variant (9) lacks multiple 5' eons, but has an alternate 5' exon, as compared to variant 1. The resulting isoform (9) is much shorter and has a different N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...