ELAVL2 (NM_001171195) Human Untagged Clone

CAT#: SC328556

ELAVL2 (untagged)-Human ELAV (embryonic lethal abnormal vision Drosophila)-like 2 (Hu antigen B) (ELAVL2) transcript variant 2



  "NM_001171195" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
HuB/HuD Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-N1; HELN1; HUB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328556 representing NM_001171195.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAACACAACTGTCTAATGGGCCAACTTGCAATAACACAGCCAATGGTCCAACCACCATAAACAAC
AACTGTTCGTCACCAGTTGACTCTGGGAACACAGAAGACAGCAAGACCAACTTAATAGTCAACTACCTT
CCTCAGAACATGACACAGGAGGAACTAAAGAGTCTCTTTGGGAGCATTGGTGAAATAGAGTCCTGTAAG
CTTGTAAGAGACAAAATAACAGGGCAGAGCTTGGGATATGGCTTTGTGAACTACATTGACCCCAAGGAT
GCAGAGAAAGCTATCAACACCCTGAATGGATTGAGACTTCAAACCAAAACAATAAAAGTTTCCTATGCT
CGCCCAAGTTCAGCTTCTATCAGAGATGCAAATTTATATGTCAGCGGACTTCCAAAAACAATGACCCAG
AAGGAGTTGGAACAGCTTTTTTCACAATATGGACGCATTATTACTTCTCGTATTCTTGTCGACCAGGTC
ACTGGCATATCAAGGGGTGTAGGGTTTATTCGATTTGACAAGCGAATTGAGGCAGAAGAAGCTATCAAA
GGCCTAAATGGCCAGAAACCTCCCGGTGCCACGGAGCCAATCACTGTAAAGTTTGCTAATAACCCAAGC
CAAAAAACCAATCAGGCCATCCTTTCCCAGCTGTACCAGTCTCCAAACAGAAGGTATCCAGGACCGCTA
GCTCAGCAGGCACAGCGTTTTAGGTTTTCTCCAATGACCATTGACGGAATGACCAGTTTGGCTGGAATT
AATATCCCTGGGCACCCTGGAACAGGGTGGTGTATATTTGTGTACAACCTGGCTCCTGACGCAGATGAG
AGTATCCTGTGGCAAATGTTTGGGCCTTTTGGAGCTGTCACCAATGTGAAGGTCATCCGTGACTTTAAC
ACCAATAAATGCAAAGGTTTTGGATTTGTGACTATGACAAACTATGATGAGGCTGCCATGGCGATAGCT
AGCCTCAATGGATACCGTCTGGGAGACAGAGTACTGCAGGTCTCCTTTAAGACAAACAAAACGCACAAA
GCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001171195
Insert Size 1041 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001171195.1
RefSeq Size 3756 bp
RefSeq ORF 1041 bp
Locus ID 1993
UniProt ID Q12926
Protein Families Transcription Factors
MW 38 kDa
Gene Summary In humans, the ELAV like RNA binding protein gene family has four members (ELAVL1-4). ELAVL RNA binding proteins recognize AU-rich elements in the 3' UTRs of gene transcripts and thereby regulate gene expression post-transcriptionally. The protein encoded by this gene binds to several 3' UTRs, including its own and also that of FOS, ID, and POU5F1. This gene encodes ELAVL2 and, like ELAVL3 and ELAVL4, is expressed specifically in neurons and primarily localizes to the cytoplasm. This protein also forms a cytosolic complex with the normally nuclear-localized ELAVL1 protein. Alternative splicing of this gene results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 2 and 3 both encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...