CD244 (NM_001166663) Human Untagged Clone

CAT#: SC328592

CD244 (untagged)-Human CD244 molecule natural killer cell receptor 2B4 (CD244) transcript variant 2



  "NM_001166663" in other vectors (4)

CNY 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CD244 mouse monoclonal antibody,clone OTI1B12
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2B4; NAIL; NKR2B4; Nmrk; SLAMF4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328592 representing NM_001166663.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGGGGCAAGTGGTCACCCTCATACTCCTCCTGCTCCTCAAGGTGTATCAGGGCAAAGGATGCCAG
GGATCAGCTGACCATGTGGTTAGCATCTCGGGAGTGCCTCTTCAGTTACAACCAAACAGCATACAGACG
AAGGTTGACAGCATTGCATGGAAGAAGTTGCTGCCCTCACAAAATGGATTTCATCACATATTGAAGTGG
GAGAATGGCTCTTTGCCTTCCAATACTTCCAATGATAGATTCAGTTTTATAGTCAAGAACTTGAGTCTT
CTCATCAAGGCAGCTCAGCAGCAGGACAGTGGCCTCTACTGCCTGGAGGTCACCAGTATATCTGGAAAA
GTTCAGACAGCCACGTTCCAGGTTTTTGTATTTGAATCTCTGCTTCCAGATAAAGTTGAGAAACCCCGC
CTACAGGGGCAGGGGAAGATCCTGGACAGAGGGAGATGCCAAGTGGCTCTGTCTTGCTTGGTCTCCAGG
GATGGCAATGTGTCCTATGCTTGGTACAGAGGGAGCAAGCTGATCCAGACAGCAGGGAACCTCACCTAC
CTGGACGAGGAGGTTGACATTAATGGCACTCACACATATACCTGCAATGTCAGCAATCCTGTTAGCTGG
GAAAGCCACACCCTGAATCTCACTCAGGACTGTCAGAATGCCCATCAGGAATTCAGATTTTGGCCGTTT
TTGGTGATCATCGTGATTCTAAGCGCACTGTTCCTTGGCACCCTTGCCTGCTTCTGTGTGTGGAGGAGA
AAGAGGAAGGAGAAGCAGTCAGAGACCAGTCCCAAGGAATTTTTGACAATTTACGAAGATGTCAAGGAT
CTGAAAACCAGGAGAAATCACGAGCAGGAGCAGACTTTTCCTGGAGGGGGGAGCACCATCTACTCTATG
ATCCAGTCCCAGTCTTCTGCTCCCACGTCACAAGAACCTGCATATACATTATATTCATTAATTCAGCCT
TCCAGGAAGTCTGGATCCAGGAAGAGGAACCACAGCCCTTCCTTCAATAGCACTATCTATGAAGTGATT
GGAAAGAGTCAACCTAAAGCCCAGAACCCTGCTCGATTGAGCCGCAAAGAGCTGGAGAACTTTGATGTT
TATTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166663
Insert Size 1113 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166663.1
RefSeq Size 2543 bp
RefSeq ORF 1113 bp
Locus ID 51744
UniProt ID Q9BZW8
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
MW 41.6 kDa
Gene Summary This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) uses an alternate acceptor splice site at one of the coding exons compared to variant 1, resulting in an isoform (2) that is 5 aa longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...