United States
Germany
Japan
United Kingdom
China
TAZ (WWTR1) (NM_001168278) Human Untagged Clone
CAT＃: SC328639
WWTR1 (untagged)-Human WW domain containing transcription regulator 1 (WWTR1) transcript variant 2
CNY 5,488.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TAZ |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001168278, the custom clone sequence may differ by one or more nucleotides
ATGAATCCGGCCTCGGCGCCCCCTCCGCTCCCGCCGCCTGGGCAGCAAGTGATCCACGTCACGCAGGACC TAGACACAGACCTCGAAGCCCTCTTCAACTCTGTCATGAATCCGAAGCCTAGCTCGTGGCGGAAGAAGAT CCTGCCGGAGTCTTTCTTTAAGGAGCCTGATTCGGGCTCGCACTCGCGCCAGTCCAGCACCGACTCGTCG GGCGGCCACCCGGGGCCTCGACTGGCTGGGGGTGCCCAGCATGTCCGCTCGCACTCGTCGCCCGCGTCCC TGCAGCTGGGCACCGGCGCGGGTGCTGCGGGTAGCCCCGCGCAGCAGCACGCGCACCTCCGCCAGCAGTC CTACGACGTGACCGACGAGCTGCCACTGCCCCCGGGCTGGGAGATGACCTTCACGGCCACTGGCCAGAGG TACTTCCTCAATCACATAGAAAAAATCACCACATGGCAAGACCCTAGGAAGGCGATGAATCAGCCTCTGA ATCATATGAACCTCCACCCTGCCGTCAGTTCCACACCAGTGCCTCAGAGGTCCATGGCAGTATCCCAGCC AAATCTCGTGATGAATCACCAACACCAGCAGCAGATGGCCCCCAGTACCCTGAGCCAGCAGAACCACCCC ACTCAGAACCCACCCGCAGGGCTCATGAGTATGCCCAATGCGCTGACCACTCAGCAGCAGCAGCAGCAGA AACTGCGGCTTCAGAGAATCCAGATGGAGAGAGAAAGGATTCGAATGCGCCAAGAGGAGCTCATGAGGCA GGAAGCTGCCCTCTGTCGACAGCTCCCCATGGAAGCTGAGACTCTTGCCCCAGTTCAGGCTGCTGTCAAC CCACCCACGATGACCCCAGACATGAGATCCATCACTAATAATAGCTCAGATCCTTTCCTCAATGGAGGGC CATATCATTCGAGGGAGCAGAGCACTGACAGTGGCCTGGGGTTAGGGTGCTACAGTGTCCCCACAACTCC GGAGGACTTCCTCAGCAATGTGGATGAGATGGATACAGGAGAAAACGCAGGACAAACACCCATGAACATC AATCCCCAACAGACCCGTTTCCCTGATTTCCTTGACTGTCTTCCAGGAACAAACGTTGACTTAGGAACTT TGGAATCTGAAGACCTGATCCCCCTCTTCAATGATGTAGAGTCTGCTCTGAACAAAAGTGAGCCCTTTCT AACCTGGCTGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001168278 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001168278.1, NP_001161750.1 |
| RefSeq Size | 5052 bp |
| RefSeq ORF | 1203 bp |
| Locus ID | 25937 |
| UniProt ID | Q9GZV5 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | Transcriptional coactivator which acts as a downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. WWTR1 enhances PAX8 and NKX2-1/TTF1-dependent gene activation. Regulates the nuclear accumulation of SMADS and has a key role in coupling them to the transcriptional machinery such as the mediator complex. Regulates embryonic stem-cell self-renewal, promotes cell proliferation and epithelial-mesenchymal transition.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 4. Variants 1 through 4 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Up regulation of the Hippo signalling effector YAP1 is linked to early biochemical recurrence in prostate cancers
,Marx, A;Schumann, A;Höflmayer, D;Bady, E;Hube-Magg, C;Möller, K;Tsourlakis, MC;Steurer, S;Büscheck, F;Eichenauer, T;Clauditz, TS;Graefen, M;Simon, R;Sauter, G;Izbicki, JR;Huland, H;Heinzer, H;Haese, A;Schlomm, T;Bernreuther, C;Lebok, P;Polonski, A;,
Sci Rep
,PubMed ID 32488048
[WWTR1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC230001 | WWTR1 (Myc-DDK-tagged)-Human WW domain containing transcription regulator 1 (WWTR1), transcript variant 2 |
CNY 5,488.00 |
|
| RC230001L1 | Lenti-ORF clone of WWTR1 (Myc-DDK-tagged)-Human WW domain containing transcription regulator 1 (WWTR1), transcript variant 2 |
CNY 7,888.00 |
|
| RC230001L2 | Lenti-ORF clone of WWTR1 (mGFP-tagged)-Human WW domain containing transcription regulator 1 (WWTR1), transcript variant 2 |
CNY 7,888.00 |
|
| RC230001L3 | Lenti-ORF clone of WWTR1 (Myc-DDK-tagged)-Human WW domain containing transcription regulator 1 (WWTR1), transcript variant 2 |
CNY 5,890.00 |
|
| RC230001L4 | Lenti-ORF clone of WWTR1 (mGFP-tagged)-Human WW domain containing transcription regulator 1 (WWTR1), transcript variant 2 |
CNY 5,890.00 |
|
| RG230001 | WWTR1 (tGFP-tagged) - Human WW domain containing transcription regulator 1 (WWTR1), transcript variant 2 |
CNY 4,370.00 |
