TMPRSS4 (NM_001173551) Human Untagged Clone
CAT#: SC328719
TMPRSS4 (untagged)-Human transmembrane protease serine 4 (TMPRSS4) transcript variant 4
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAP2; CAPH2; MT-SP2; TMPRSS3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001173551, the custom clone sequence may differ by one or more nucleotides
ATGGATCCTGACAGTGATCAACCTCTGAACAGCCTCGATGTCAAACCCCTGCGCAAACCC CGTATCCCCATGGAGACCTTCAGAAAGGTGGGGATCCCCATCATCATAGCACTACTGAGC CTGGCGAGTATCATCATTGTGGTTGTCCTCATCAAGGTGATTCTGGATAAATACTACTTC CTCTGCGGGCAGCCTCTCCACTTCATCCCGAGGAAGCAGCTGTGTGACGGAGAGCTGGAC TGTCCCTTGGGGGAGGACGAGGAGCACTGTGTCAAGAGCTTCCCCGAAGGGCCTGCAGTG GCAGTCCGCCTCTCCAAGGACCGATCCACACTGCAGGTGCTGGACTCGGCCACAGGGAAC TGGTTCTCTGCCTGTTTCGACAACTTCACAGAAGCTCTCGCTGAGACAGCCTGTAGGCAG ATGGGCTACAGCAGCAAACCCACTTTCAGAGCTGTGGAGATTGGCCCAGACCAGGATCTG GATGTTGTTGAAATCACAGAAAACAGCCAGGAGCTTCGCATGCGGAACTCAAGTGGGCCC TGTCTCTCAGGCTCCCTGGTCTCCCTGCACTGTCTTGCCTGTGGGAAGAGCCTGAAGACC CCCCGTGTGGTGGGTGGGGAGGAGGCCTCTGTGGATTCTTGGCCTTGGCAGGTCAGCATC CAGTACGACAAACAGCACGTCTGTGGAGGGAGCATCCTGGACCCCCACTGGGTCCTCACG GCAGCCCACTGCTTCAGGAAACATACCGATGTGTTCAACTGGAAGGTGCGGGCAGGCTCA GACAAACTGGGCAGCTTCCCATCCCTGGCTGTGGCCAAGATCATCATCATTGAATTCAAC CCCATGTACCCCAAAGACAATGACATCGCCCTCATGAAGCTGCAGTTCCCACTCACTTTC TCAGGCACAGTCAGGCCCATCTGTCTGCCCTTCTTTGATGAGGAGCTCACTCCAGCCACC CCACTCTGGATCATTGGATGGGGCTTTACGAAGCAGAATGGAGGGAAGATGTCTGACATA CTGCTGCAGGCGTCAGTCCAGGTCATTGACAGCACACGGTGCAATGCAGACGATGCGTAC CAGGGGGAAGTCACCGAGAAGATGATGTGTGCAGGCATCCCGGAAGGGGGTGTGGACACC TGCCAGGGTGACAGTGGTGGGCCCCTGATGTACCAATCTGACCAGTGGCATGTGGTGGGC ATCGTTAGTTGGGGCTATGGCTGCGGGGGCCCGAGCACCCCAGGAGTATACACCAAGGTC TCAGCCTATCTCAACTGGATCTACAATGTCTGGAAGGCTGAGCTGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001173551 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001173551.1, NP_001167022.1 |
RefSeq Size | 3543 bp |
RefSeq ORF | 1308 bp |
Locus ID | 56649 |
Protein Families | Druggable Genome, Protease, Transmembrane |
Gene Summary | This gene encodes a member of the serine protease family. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified as a gene overexpressed in pancreatic carcinoma. The encoded protein is membrane bound with a N-terminal anchor sequence and a glycosylated extracellular region containing the serine protease domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The resulting isoform (4) lacks an internal 3-aa segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230081 | TMPRSS4 (Myc-DDK-tagged)-Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 4 |
CNY 5,856.00 |
|
RC230081L3 | Lenti-ORF clone of TMPRSS4 (Myc-DDK-tagged)-Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 4 |
CNY 5,890.00 |
|
RC230081L4 | Lenti-ORF clone of TMPRSS4 (mGFP-tagged)-Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 4 |
CNY 5,890.00 |
|
RG230081 | TMPRSS4 (tGFP-tagged) - Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 4 |
CNY 4,370.00 |
其它TMPRSS4产品