TFEB (NM_001167827) Human Untagged Clone
CAT#: SC328779
TFEB (untagged)-Human transcription factor EB (TFEB) transcript variant 2
CNY 5,488.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALPHATFEB; BHLHE35; TCFEB |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001167827, the custom clone sequence may differ by one or more nucleotides
ATGACAGCAAGCTCAGGCTGGGAGCCAGCGCCGGCAGCCACCATGGCGTCACGCATAGGGTTGCGCATGC AGCTCATGCGGGAGCAGGCGCAGCAGGAGGAGCAGCGGGAGCGCATGCAGCAACAGGCTGTCATGCATTA CATGCAGCAGCAGCAGCAGCAGCAACAGCAGCAGCTCGGAGGGCCGCCCACCCCGGCCATCAATACCCCC GTCCACTTCCAGTCGCCACCACCTGTGCCTGGGGAGGTGTTGAAGGTGCAGTCCTACCTGGAGAATCCCA CATCCTACCATCTGCAGCAGTCGCAGCATCAGAAGGTGCGGGAGTACCTGTCCGAGACCTATGGGAACAA GTTTGCTGCCCACATCAGCCCAGCCCAGGGCTCTCCGAAACCCCCACCAGCCGCCTCCCCAGGGGTGCGA GCTGGACACGTGCTGTCCTCCTCCGCTGGCAACAGTGCTCCCAATAGCCCCATGGCCATGCTGCACATTG GCTCCAACCCTGAGAGGGAGTTGGATGATGTCATTGACAACATTATGCGTCTGGACGATGTCCTTGGCTA CATCAATCCTGAAATGCAGATGCCCAACACGCTACCCCTGTCCAGCAGCCACCTGAATGTGTACAGCAGC GACCCCCAGGTCACAGCCTCCCTGGTGGGCGTCACCAGCAGCTCCTGCCCTGCGGACCTGACCCAGAAGC GAGAGCTCACAGATGCTGAGAGCAGGGCCCTGGCCAAGGAGCGGCAGAAGAAAGACAATCACAACTTAAT TGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAAT GACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGA AGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTG GCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATG AACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCC TGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCT GCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCACAGCCTGAGCTTTGGGGGCAGGGAG GACGAGGGTCCCCCGGGCTACCCCGAACCCCTGGCGCCGGGGCATGGCTCCCCATTCCCCAGCCTGTCCA AGAAGGATCTGGACCTCATGCTCCTGGACGACTCACTGCTACCGCTGGCCTCTGATCCACTTCTGTCCAC CATGTCCCCCGAGGCCTCCAAGGCCAGCAGCCGCCGGAGCAGCTTCAGCATGGAGGAGGGCGATGTGCTG TGA |
Restriction Sites | Please inquire |
ACCN | NM_001167827 |
Insert Size | 2400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001167827.1, NP_001161299.1 |
RefSeq Size | 2198 bp |
RefSeq ORF | 1431 bp |
Locus ID | 7942 |
UniProt ID | P19484 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Transcription factor that specifically recognizes and binds E-box sequences (5'-CANNTG-3'). Efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFE3 or MITF. In association with TFE3, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity. Specifically recognizes and binds the CLEAR-box sequence (5'-GTCACGTGAC-3') present in the regulatory region of many lysosomal genes, leading to activate their expression. It thereby plays a central role in expression of lysosomal genes. Acts as a positive regulator of autophagy by promoting expression of genes involved in autophagy. Specifically recognizes the gamma-E3 box, a subset of E-boxes, present in the heavy-chain immunoglobulin enhancer. Plays a role in the signal transduction processes required for normal vascularization of the placenta. Regulates lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1 (PubMed:29146937).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2, also known as TFEB-A) encodes the longest isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230141 | TFEB (Myc-DDK-tagged)-Human transcription factor EB (TFEB), transcript variant 2 |
CNY 5,488.00 |
|
RC230141L1 | Lenti-ORF clone of TFEB (Myc-DDK-tagged)-Human transcription factor EB (TFEB), transcript variant 2 |
CNY 7,888.00 |
|
RC230141L2 | Lenti-ORF clone of TFEB (mGFP-tagged)-Human transcription factor EB (TFEB), transcript variant 2 |
CNY 7,888.00 |
|
RC230141L3 | Lenti-ORF clone of TFEB (Myc-DDK-tagged)-Human transcription factor EB (TFEB), transcript variant 2 |
CNY 7,888.00 |
|
RC230141L4 | Lenti-ORF clone of TFEB (mGFP-tagged)-Human transcription factor EB (TFEB), transcript variant 2 |
CNY 7,888.00 |
|
RG230141 | TFEB (tGFP-tagged) - Human transcription factor EB (TFEB), transcript variant 2 |
CNY 7,088.00 |