MLH1 (NM_001167618) Human Untagged Clone
CAT#: SC328850
MLH1 (untagged)-Human mutL homolog 1 colon cancer nonpolyposis type 2 (E. coli) (MLH1) transcript variant 3
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | COCA2; FCC2; hMLH1; HNPCC; HNPCC2; MMRCS1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001167618, the custom clone sequence may differ by one or more nucleotides
ATGAATGGTTACATATCCAATGCAAACTACTCAGTGAAGAAGTGCATCTTCTTACTCTTC ATCAACCATCGTCTGGTAGAATCAACTTCCTTGAGAAAAGCCATAGAAACAGTGTATGCA GCCTATTTGCCCAAAAACACACACCCATTCCTGTACCTCAGTTTAGAAATCAGTCCCCAG AATGTGGATGTTAATGTGCACCCCACAAAGCATGAAGTTCACTTCCTGCACGAGGAGAGC ATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAATTCCTCCAGG ATGTACTTCACCCAGACTTTGCTACCAGGACTTGCTGGCCCCTCTGGGGAGATGGTTAAA TCCACAACAAGTCTGACCTCGTCTTCTACTTCTGGAAGTAGTGATAAGGTCTATGCCCAC CAGATGGTTCGTACAGATTCCCGGGAACAGAAGCTTGATGCATTTCTGCAGCCTCTGAGC AAACCCCTGTCCAGTCAGCCCCAGGCCATTGTCACAGAGGATAAGACAGATATTTCTAGT GGCAGGGCTAGGCAGCAAGATGAGGAGATGCTTGAACTCCCAGCCCCTGCTGAAGTGGCT GCCAAAAATCAGAGCTTGGAGGGGGATACAACAAAGGGGACTTCAGAAATGTCAGAGAAG AGAGGACCTACTTCCAGCAACCCCAGAAAGAGACATCGGGAAGATTCTGATGTGGAAATG GTGGAAGATGATTCCCGAAAGGAAATGACTGCAGCTTGTACCCCCCGGAGAAGGATCATT AACCTCACTAGTGTTTTGAGTCTCCAGGAAGAAATTAATGAGCAGGGACATGAGGTTCTC CGGGAGATGTTGCATAACCACTCCTTCGTGGGCTGTGTGAATCCTCAGTGGGCCTTGGCA CAGCATCAAACCAAGTTATACCTTCTCAACACCACCAAGCTTAGTGAAGAACTGTTCTAC CAGATACTCATTTATGATTTTGCCAATTTTGGTGTTCTCAGGTTATCGGAGCCAGCACCG CTCTTTGACCTTGCCATGCTTGCCTTAGATAGTCCAGAGAGTGGCTGGACAGAGGAAGAT GGTCCCAAAGAAGGACTTGCTGAATACATTGTTGAGTTTCTGAAGAAGAAGGCTGAGATG CTTGCAGACTATTTCTCTTTGGAAATTGATGAGGAAGGGAACCTGATTGGATTACCCCTT CTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCC ACTGAGGTGAATTGGGACGAAGAAAAGGAATGTTTTGAAAGCCTCAGTAAAGAATGCGCT ATGTTCTATTCCATCCGGAAGCAGTACATATCTGAGGAGTCGACCCTCTCAGGCCAGCAG AGTGAAGTGCCTGGCTCCATTCCAAACTCCTGGAAGTGGACTGTGGAACACATTGTCTAT AAAGCCTTGCGCTCACACATTCTGCCTCCTAAACATTTCACAGAAGATGGAAATATCCTG CAGCTTGCTAACCTGCCTGATCTATACAAAGTCTTTGAGAGGTGTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001167618 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001167618.1, NP_001161090.1 |
RefSeq Size | 2473 bp |
RefSeq ORF | 1548 bp |
Locus ID | 4292 |
UniProt ID | P40692 |
Protein Families | Druggable Genome |
Protein Pathways | Colorectal cancer, Endometrial cancer, Mismatch repair, Pathways in cancer |
Gene Summary | The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017] Transcript Variant: This variant (3) contains a distinct 5'-terminal exon and uses an alternate splice site in a 5' exon and therefore lacks an in-frame portion of the 5' coding region compared to variant 1. The resulting isoform (3) has a shorter N-terminus compared to isoform 1. Variants 3, 4, and 6-12 all encode the same isoform (3). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230212 | MLH1 (Myc-DDK-tagged)-Human mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 3 |
CNY 5,130.00 |
|
RC230212L3 | Lenti-ORF clone of MLH1 (Myc-DDK-tagged)-Human mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 3 |
CNY 7,030.00 |
|
RC230212L4 | Lenti-ORF clone of MLH1 (mGFP-tagged)-Human mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 3 |
CNY 7,030.00 |
|
RG230212 | MLH1 (tGFP-tagged) - Human mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 3 |
CNY 5,610.00 |