C1D (NM_001190265) Human Untagged Clone

CAT#: SC329417

C1D (untagged) - Homo sapiens C1D nuclear receptor corepressor (C1D), transcript variant 4



  "NM_001190265" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
C1D mouse monoclonal antibody,clone OTI5H10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hC1D; LRP1; Rrp47; SUN-CoR; SUNCOR
Vector pCMV6-Entry
Sequence Data
>SC329417 representing NM_001190265.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGGTGAAGAAATTAATGAAGACTATCCAGTAGAAATTCACGAGTATTTGTCAGCGTTTGAGAAT
TCCATTGGTGCTGTGGATGAGATGCTGAAGACCATGATGTCTGTTTCTAGAAATGAGTTGTTGCAGAAG
TTGGATCCACTTGAACAAGCAAAAGTGGATTTGGTTTCTGCATACACATTAAATTCAATGTTTTGGGTT
TATTTGGCAACCCAAGGAGTTAATCCTAAGGAACATCCAGTAAAACAGGAATTGGAAAGAATCAGAGTA
TATATGAACAGAGTCAAGGAAATAACAGACAAGAAAAAGGCTGGCAAGCTGGACAGAGGTGCAGCTTCA
AGATTTGTAAAAAATGCCCTCTGGGAACCAAAATCGAAAAATGCATCAAAAGTTGCCAATAAAGGAAAA
AGTAAAAGTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001190265
Insert Size 426 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001190265.1
RefSeq Size 1294 bp
RefSeq ORF 426 bp
Locus ID 10438
UniProt ID Q13901
Protein Families Druggable Genome
Protein Pathways RNA degradation
MW 16 kDa
Gene Summary The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10.[provided by RefSeq, Jun 2010]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...