RPH3AL (NM_001190411) Human Untagged Clone

CAT#: SC329418

RPH3AL (untagged) - Homo sapiens rabphilin 3A-like (without C2 domains) (RPH3AL), transcript variant 2



  "NM_001190411" in other vectors (2)

CNY 3,040.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


RPH3AL Antibody - C-terminal region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NOC2
Vector pCMV6-Entry
Sequence Data
>SC329418 representing NM_001190411.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCGACACCATCTTCGGCAGCGGGAATGATCAGTGGGTTTGCCCCAATGACCGGCAGCTTGCCCTT
CGAGCCAAGCTGCAGACGGGCTGGTCCGTGCACACCTACCAGACGGAGAAGCAGAGGAGGAAGCAGCAC
CTCAGCCCGGCGGAGGTGGAGGCCATCCTGCAGGTCATCCAGAGGGCAGAGCGGCTCGACGTCCTGGAG
CAGCAGAGAATCGGGCGGCTGGTGGAGCGGCTGGAGACCATGAGGCGGAATGTGATGGGGAACGGCCTG
TCCCAGTGTCTGCTCTGCGGGGAGGTGCTGGGCTTCCTGGGCAGCTCGTCGGTGTTCTGCAAAGACTGC
AGGAAGAAAGTCTGCACCAAATGTGGGATCGAGGCCTCCCCTGGCCAGAAGCGGCCCCTGTGGCTGTGT
AAGATCTGCAGTGAGCAAAGAGAGGTCTGGAAGAGGTCGGGGGCCTGGTTCTACAAAGGGCTCCCCAAG
TATATCTTGCCCCTGAAGACCCCTGGCCGAGCTGATGACCCCCACTTCCGACCTTTGCCCACGGAACCG
GCAGAGCGAGAGCCCAGAAGCTCTGAGACCAGCCGCATCTACACGTGGGCCCGAGGAAGAGTGGTTTCC
AGTGACAGTGACAGTGACTCGGATCTTAGCTCCTCCAGCCTAGAGGACAGACTCCCATCCACTGGGGTC
AGGGACCGGAAAGGCGACAAACCCTGGAAGGAGTCAGGTGGCAGCGTGGAGGCCCCCAGGATGGGGTTC
ACCCACCCGCCGGGCCACCTCTCTGGGTGCCAGAGCAGCCTGGCCAGTGGTGAGACGGGGACAGGCTCT
GCTGACCCGCCAGGGGGACCCCGCCCCGGGCTGACCCGAAGGGCCCCGGTAAAAGACACACCTGGACGA
GCCCCCGCTGCTGACGCAGCTCCAGCAGGCCCCTCCAGCTGCCTGGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001190411
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001190411.1
RefSeq Size 2578 bp
RefSeq ORF 948 bp
Locus ID 9501
UniProt ID Q9UNE2
Protein Families Secreted Protein
MW 34.5 kDa
Gene Summary The protein encoded by this gene plays a direct regulatory role in calcium-ion-dependent exocytosis in both endocrine and exocrine cells and plays a key role in insulin secretion by pancreatic cells. This gene is likely a tumor suppressor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1, and encodes isoform 1. Variants 1 and 2 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...