SUV39H2 (NM_001193425) Human Untagged Clone

CAT#: SC329431

SUV39H2 (untagged) - Homo sapiens suppressor of variegation 3-9 homolog 2 (Drosophila) (SUV39H2), transcript variant 2



  "NM_001193425" in other vectors (2)

CNY 3,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SUV39H2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KMT1B
Vector pCMV6-Entry
Sequence Data
>SC329431 representing NM_001193425.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAATATTATCTTGTAAAATGGAAAGGATGGCCAGATTCTACAAATACTTGGGAACCTTTGCAAAAT
CTGAAGTGCCCGTTACTGCTTCAGCAATTCTCTAATGACAAGCATAATTATTTATCTCAGGTAAAGAAA
GGCAAAGCAATAACTCCAAAAGACAATAACAAAACTTTGAAACCTGCCATTGCTGAGTACATTGTGAAG
AAGGCTAAACAAAGGATAGCTCTGCAGAGATGGCAAGATGAACTCAACAGAAGAAAGAATCATAAAGGA
ATGATATTTGTTGAAAATACTGTTGATTTAGAGGGCCCACCTTCAGACTTCTATTACATTAACGAATAC
AAACCAGCTCCTGGAATCAGCTTAGTCAATGAAGCTACCTTTGGTTGTTCATGCACAGATTGCTTCTTT
CAAAAATGTTGTCCTGCTGAAGCTGGAGTTCTTTTGGCTTATAATAAAAACCAACAAATTAAAATCCCA
CCTGGTACTCCCATCTATGAATGCAACTCAAGGTGTCAGTGTGGTCCTGATTGTCCCAATAGGATTGTA
CAAAAAGGCACACAGTATTCGCTTTGCATCTTTCGAACTAGCAATGGACGTGGCTGGGGTGTAAAGACC
CTTGTGAAGATTAAAAGAATGAGTTTTGTCATGGAATATGTTGGAGAGGTAATCACAAGTGAAGAAGCT
GAAAGACGAGGACAGTTCTATGACAACAAGGGAATCACGTATCTCTTTGATCTGGACTATGAGTCTGAT
GAATTCACAGTGGATGCGGCTCGATACGGCAATGTGTCTCATTTTGTGAATCACAGCTGTGACCCAAAT
CTTCAGGTGTTCAATGTTTTCATTGATAACCTCGATACTCGTCTTCCCCGAATAGCATTGTTTTCCACA
AGAACCATAAATGCTGGAGAAGAGCTGACTTTTGATTATCAAATGAAAGGTTCTGGAGATATATCTTCA
GATTCTATTGACCACAGCCCAGCCAAAAAGAGGGTCAGAACAGTATGTAAATGTGGAGCTGTGACTTGC
AGAGGTTACCTCAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001193425
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001193425.1
RefSeq Size 3106 bp
RefSeq ORF 1053 bp
Locus ID 79723
UniProt ID Q9H5I1
Protein Families Druggable Genome
Protein Pathways Lysine degradation
MW 39.9 kDa
Gene Summary Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys-9' as substrate. H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as cell cycle regulation, transcriptional repression and regulation of telomere length. May participate in regulation of higher-order chromatin organization during spermatogenesis. Recruited by the large PER complex to the E-box elements of the circadian target genes such as PER2 itself or PER1, contributes to the conversion of local chromatin to a heterochromatin-like repressive state through H3 'Lys-9' trimethylation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon compared to variant 1. This results in translation initiation from an in-frame, downstream AUG, and a shorter isoform (2) compared to isoform 1. Variants 2 and 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...