STMN2 (NM_001199214) Human Untagged Clone

CAT#: SC329498

STMN2 (untagged) - Homo sapiens stathmin-like 2 (STMN2), transcript variant 1



  "NM_001199214" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-STMN2/STMN3/STMN4 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SCG10; SCGN10
Vector pCMV6-Entry
Sequence Data
>SC329498 representing NM_001199214.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTAAAACAGCAATGGCCTACAAGGAAAAAATGAAGGAGCTGTCCATGCTGTCACTGATCTGCTCT
TGCTTTTACCCGGAACCTCGCAACATCAACATCTATACTTACGATGATATGGAAGTGAAGCAAATCAAC
AAACGTGCCTCTGGCCAGGCTTTTGAGCTGATCTTGAAGCCACCATCTCCTATCTCAGAAGCCCCACGA
ACTTTAGCTTCTCCAAAGAAGAAAGACCTGTCCCTGGAGGAGATCCAGAAGAAACTGGAGGCTGCAGAG
GAAAGAAGAAAGTCTCAGGAGGCCCAGGTGCTGAAACAATTGGCAGAGAAGAGGGAACACGAGCGAGAA
GTCCTTCAGAAGGCTTTGGAGGAGAACAACAACTTCAGCAAGATGGCGGAGGAAAAGCTGATCCTGAAA
ATGGAACAAATTAAGGAAAACCGTGAGGCTAATCTAGCTGCTATTATTGAACGTCTGCAGGAAAAGCTG
GTCAAGTTTATTTCTTCTGAACTAAAAGAATCTATAGAGTCTCAATTTCTGGAGCTTCAGAGGGAAGGA
GAGAAGCAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001199214
Insert Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199214.1
RefSeq Size 2314 bp
RefSeq ORF 564 bp
Locus ID 11075
UniProt ID Q93045
MW 21.8 kDa
Gene Summary This gene encodes a member of the stathmin family of phosphoproteins. Stathmin proteins function in microtubule dynamics and signal transduction. The encoded protein plays a regulatory role in neuronal growth and is also thought to be involved in osteogenesis. Reductions in the expression of this gene have been associated with Down's syndrome and Alzheimer's disease. Alternatively spliced transcript variants have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...