CIDE C (CIDEC) (NM_001199552) Human Untagged Clone

CAT#: SC329533

CIDEC (untagged) - Homo sapiens cell death-inducing DFFA-like effector c (CIDEC), transcript variant 4



  "NM_001199552" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CIDEC rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CIDE-3; CIDE3; FPLD5; FSP27
Vector pCMV6-Entry
Sequence Data
>SC329533 representing NM_001199552.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAATACGCCATGAAGTCCCTTAGCCTTCTCTACCCCAAGTCCCTCTCCAGGCATGTGTCAGTGCGT
ACCTCTGTGGTGACCCAGCAGCTGCTGTCGGAGCCCAGCCCCAAGGCCCCCAGGGCCCGGCCCTGCCGC
GTAAGCACGGCGGATCGAAGCGTGAGGAAGGGCATCATGGCTTACAGTCTTGAGGACCTCCTCCTCAAG
GTCCGGGACACTCTGATGCTGGCAGACAAGCCCTTCTTCCTGGTGCTGGAGGAAGATGGCACAACTGTA
GAGACAGAAGAGTACTTCCAAGCCCTGGCAGGGGATACAGTGTTCATGGTCCTCCAGAAGGGGCAGAAA
TGGCAGCCCCCATCAGAACAGGGGACAAGGCACCCACTGTCCCTCTCCCATAAGCCTGCCAAGAAGATT
GATGTGGCCCGTGTAACGTTTGATCTGTACAAGCTGAACCCACAGGACTTCATTGGCTGCCTGAACGTG
AAGGCGACTTTTTATGATACATACTCCCTTTCCTATGATCTGCACTGCTGTGGGGCCAAGCGCATCATG
AAGGAAGCTTTCCGCTGGGCCCTCTTCAGCATGCAGGCCACAGGCCACGTACTGCTTGGCACCTCCTGT
TACCTGCAGCAGCTCCTCGATGCTACGGAGGAAGGGCAGCCCCCCAAGGGCAAGGCCTCATCCCTTATC
CCGACCTGTCTGAAGATACTGCAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199552
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199552.1
RefSeq Size 1214 bp
RefSeq ORF 717 bp
Locus ID 63924
UniProt ID Q96AQ7
Protein Families Druggable Genome
MW 26.8 kDa
Gene Summary This gene encodes a member of the cell death-inducing DNA fragmentation factor-like effector family. Members of this family play important roles in apoptosis. The encoded protein promotes lipid droplet formation in adipocytes and may mediate adipocyte apoptosis. This gene is regulated by insulin and its expression is positively correlated with insulin sensitivity. Mutations in this gene may contribute to insulin resistant diabetes. A pseudogene of this gene is located on the short arm of chromosome 3. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. This variant encodes isoform 3, which is shorter than isoform 1. Variants 3 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...