Calumenin (CALU) (NM_001199674) Human Untagged Clone

CAT#: SC329546

CALU (untagged) - Homo sapiens calumenin (CALU), transcript variant 6



  "NM_001199674" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CALU Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FLJ90608
Vector pCMV6-Entry
Sequence Data
>SC329546 representing NM_001199674.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGGTTAGAGATGAGCGGAGGTTTAAAATGGCAGACAAGGATGGAGACCTCATTGCCACCAAGGAG
GAGTTCACAGCTTTCCTGCACCCTGAGGAGTATGACTACATGAAAGATATAGTAGTACAGGAAACAATG
GAAGATATAGATAAGAATGCTGATGGTTTCATTGATCTAGAAGAGTATATTGGTGACATGTACAGCCAT
GATGGGAATACTGATGAGCCAGAATGGGTAAAGACAGAGCGAGAGCAGTTTGTTGAGTTTCGGGATAAG
AACCGTGATGGGAAGATGGACAAGGAAGAGACCAAAGACTGGATCCTTCCCTCAGACTATGATCATGCA
GAGGCAGAAGCCAGGCACCTGGTCTATGAATCAGACCAAAACAAGGATGGCAAGCTTACCAAGGAGGAG
ATCGTTGACAAGTATGACTTATTTGTTGGCAGCCAGGCCACAGATTTTGGGGAGGCCTTAGTACGGCAT
GATGAGTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199674
Insert Size 495 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199674.1
RefSeq Size 4940 bp
RefSeq ORF 495 bp
Locus ID 813
Protein Families Secreted Protein
MW 19.5 kDa
Gene Summary The product of this gene is a calcium-binding protein localized in the endoplasmic reticulum (ER) and it is involved in such ER functions as protein folding and sorting. This protein belongs to a family of multiple EF-hand proteins (CERC) that include reticulocalbin, ERC-55, and Cab45 and the product of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (6) lacks two consecutive exons in the 5' region, resulting in a downstream AUG start codon, compared to variant 1. The resulting isoform (f) has a shorter N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...