GADD45A (NM_001199742) Human Untagged Clone

CAT#: SC329553

GADD45A (untagged) - Homo sapiens growth arrest and DNA-damage-inducible, alpha (GADD45A), transcript variant 3



  "NM_001199742" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GADD45A mouse monoclonal antibody, clone OTI1C9 (formerly 1C9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DDIT1; GADD45
Vector pCMV6-Entry
Sequence Data
>SC329553 representing NM_001199742.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTTTGGAGGAATTCTCGGCTGGAGAGCAGAAGACCGAAAGGATGGATAAGGTGGGGGATGCCCTG
GAGGAAGTGCTCAGCAAAGCCCTGAGTCAGCGCACGATCACTGTCGGGGTGTACGAAGCGGCCAAGCTG
CTCAACGTAATCCACATTCATCTCAATGGAAGGATCCTGCCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199742
Insert Size 183 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199742.1
RefSeq Size 1160 bp
RefSeq ORF 183 bp
Locus ID 1647
UniProt ID P24522
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Cell cycle, MAPK signaling pathway, p53 signaling pathway
MW 6.7 kDa
Gene Summary This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The DNA damage-induced transcription of this gene is mediated by both p53-dependent and -independent mechanisms. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) lacks a coding exon, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...