DAP3 (NM_001199849) Human Untagged Clone

CAT#: SC329573

DAP3 (untagged) - Homo sapiens death associated protein 3 (DAP3), transcript variant 3



  "NM_001199849" in other vectors (2)

CNY 3,800.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
DAP3 mouse monoclonal antibody, clone OTI1B12 (formerly 1B12)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bMRP-10; DAP-3; MRP-S29; MRPS29; S29mt
Vector pCMV6-Entry
Sequence Data
>SC329573 representing NM_001199849.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGCTGAAAGGAATAACAAGGCTTATCTCTAGGATCCATAAGTTGGACCCTGGGCGTTTTTTACAC
ATGGGGACCCAGGCTCGCCAAAGCATTGCTGCTCACCTAGATAACCAGGTTCCAGTTGAGAGTCCGAGA
GCTATTTCCCGCACCAATGAGAATGACCCGGCCAAGCATGGGGATCAGCACGAGGGTCAGCACTACAAC
ATCTCCCCCCAGGATTTGGAGACTGTATTTCCCCATGGCCTTCCTCCTCGCTTTGTGATGCAGGTGAAG
ACATTCAGTGAAGCTTGCCTGATGGTAAGGAAACCAGCCCTAGAACTTCTGCATTACCTGAAAAACACC
AGTTTTGCTTATCCAGCTATACGATATCTTCTGTATGGAGAGAAGGGAACAGGAAAAACCCTAAGTCTT
TGCCATGTTATTCATTTCTGTGCAAAACAGGACTGGCTGATACTACATATTCCAGATGCTCATCTTTGG
GTGAAAAATTGTCGGGATCTTCTGCAGTCCAGCTACAACAAACAGCGCTTTGATCAACCTTTAGAGGCT
TCAACCTGGCTGAAGAATTTCAAAACTACAAATGAGCGCTTCCTGAACCAGATAAAAGTTCAAGAGAAG
TATGTCTGGAATAAGAGAGAAAGCACTGAGAAAGGGAGTCCTCTGGGAGAAGTGGTTGAACAGGGCATA
ACACGGGTGAGGAACGCCACAGATGCAGTTGGAATTGTGCTGAAAGAGCTAAAGAGGCAAAGTTCTTTG
GGTATGTTTCACCTCCTAGTGGCCGTGGATGGAATCAATGCTCTTTGGGGAAGAACCACTCTGAAAAGA
GAAGATAAAAGCCCGATTGCCCCCGAGGAATTAGCACTTGTTCACAACTTGAGGAAAATGATGAAAAAT
GATTGGCATGGAGGCGCCATTGTGTCGGCTTTGAGCCAGACTGGGTCTCTCTTTAAGCCCCGGAAAGCC
TATCTGCCCCAGGAGTTGCTGGGAAAGGAAGGATTTGATGCCCTGGATCCCTTTATTCCCATCCTGGTT
TCCAACTATAACCCAAAGGAATTTGAAAGTTGTATTCAGTATTATTTGGAAAACAATTGGCTTCAACAT
GAGAAAGCTCCTACAGAAGAAGGGAAAAAAGAGCTGCTGTTCCTAAGTAACGCGAACCCCTCGCTGCTG
GAGCGGCACTGTGCCTACCTCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199849
Insert Size 1197 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199849.1
RefSeq Size 2161 bp
RefSeq ORF 1197 bp
Locus ID 7818
UniProt ID P51398
Protein Families Druggable Genome
MW 45.6 kDa
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) has an additional exon in the 5' UTR, as compared to variant 2. Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...