HYAL3 (NM_001200032) Human Untagged Clone
CAT#: SC329612
HYAL3 (untagged) - Homo sapiens hyaluronoglucosaminidase 3 (HYAL3), transcript variant 4
CNY 2,950.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HYAL-3; LUCA-3; LUCA3 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329612 representing NM_001200032.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCTGCCACCTGCCCACCACCAGGCCTTTGTCCGACATCGCCTGGAGGAGGCCTTCCGTGTGGCCCTT GTTGGGCACCGACATCCCCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCGGAGATCTGGGAGGTTC CTGTCCCAGGAGGAGTGCTGGCATCTCCATGACTACCTGGTGGACACCTTGGGCCCCTATGTGATCAAT GTGACCAGGGCAGCGATGGCCTGCAGTCACCAGCGGTGCCATGGCCACGGGCGCTGTGCCCGGCGAGAT CCAGGACAGATGGAAGCCTTTCTACACCTGTGGCCAGACGGCAGCCTTGGAGATTGGAAGTCCTTCAGC TGCCACTGTTACTGGGGCTGGGCTGGCCCCACCTGCCAGGAGCCCAGGCCTGGGCCTAAAGAAGCAGTA TAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001200032 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001200032.1 |
RefSeq Size | 1089 bp |
RefSeq ORF | 417 bp |
Locus ID | 8372 |
UniProt ID | O43820 |
Protein Families | Secreted Protein |
Protein Pathways | Glycosaminoglycan degradation, Metabolic pathways |
MW | 15.9 kDa |
Gene Summary | This gene encodes a member of the hyaluronidase family. Hyaluronidases are endoglycosidase enzymes that degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. The regulated turnover of hyaluronan plays a critical role in many biological processes including cell proliferation, migration and differentiation. The encoded protein may also play an important role in sperm function. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression, and the expression of specific transcript variants may be indicative of tumor status. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and some isoforms may lack hyaluronidase activity. This gene overlaps and is on the same strand as N-acetyltransferase 6 (GCN5-related), and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (4), also known as HYAL3-v3, initiates translation at an upstream start codon and has multiple differences in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (4) is shorter and has a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...