Nucleotide binding protein like (NUBPL) (NM_001201574) Human Untagged Clone

CAT#: SC329639

NUBPL (untagged) - Homo sapiens nucleotide binding protein-like (NUBPL), transcript variant 3



  "NM_001201574" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
NUBPL mouse monoclonal antibody, clone OTI5D5 (formerly 5D5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C14orf127; huInd1; IND1; MC1DN21
Vector pCMV6-Entry
Sequence Data
>SC329639 representing NM_001201574.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCACCAGGAACTGGAGATGTGCAGTTATCAGTCTCACAGAATATTCCTATAACAGGTGCTGTGATT
GTCTCCACGCCCCAGGACATCGCATTGATGGATGCACACAAGGGTGCTGAGATGTTTCGCAGAGTCCAC
GTGCCCGTCCTTGGCCTTGTCCAAAACATGAGTGTTTTCCAGTGTCCAAAATGTAAACACAAAACTCAT
ATTTTTGGTGCTGATGGTGCAAGGAAACTAGCACAGACCCTTGGTCTTGAAGTTCTAGGAGACATTCCC
TTACACCTTAATATAAGGGAAGCTTCAGATACAGGCCAGCCAATTGTGTTTTCACAGCCTGAAAGTGAT
GAGGCCAAAGCTTACTTGAGGATTGCTGTGGAAGTGGTAAGAAGATTGCCATCACCTTCAGAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001201574
Insert Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001201574.1
RefSeq Size 2739 bp
RefSeq ORF 411 bp
Locus ID 80224
MW 14.7 kDa
Gene Summary This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (3) lacks several exons from the 5' end and has an alternate 5' exon, as compared to variant 1. The resulting isoform (3) has a much shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Nucleotide binding protein like产品

Customer Reviews 
Loading...