ZNF 559 (ZNF559) (NM_001202411) Human Untagged Clone

CAT#: SC329647

ZNF559 (untagged) - Homo sapiens zinc finger protein 559 (ZNF559), transcript variant 7



  "NM_001202411" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ZNF559 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NBLA00121
Vector pCMV6-Entry
Sequence Data
>SC329647 representing NM_001202411.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGGCTGGGTGGTTGACAAATTACTCTCAGGACTCAGTGACCTTTGAGGATGTGGCTGTGGACTTC
ACCCAGGAGGAGTGGACTTTGCTGGATCAAACTCAGAGAAACTTATACAGAGATGTGATGCTGGAGAAC
TATAAGAATCTAGTTGCAGTAGATTGGGAGAGTCATATTAATACCAAATGGTCAGCACCTCAGCAGAAT
TTTTTGCAGGGGAAAACATCCAGTGTGGTGGAAATGAATTCAGAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001202411
Insert Size 255 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202411.1
RefSeq Size 3186 bp
RefSeq ORF 255 bp
Locus ID 84527
Protein Families Transcription Factors
MW 9.8 kDa
Gene Summary May be involved in transcriptional regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) includes an additional exon in its 5' UTR, uses a downstream start codon, uses an alternate splice site that causes a frameshift in the 3' coding region, and differs in the 3' UTR, compared to variant 1. The encoded isoform (f) has a shorter N-terminus, a distinct C-terminus, and is overall shorter than isoform a. Variants 6, 7 and 8 all encode isoform f.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...