ATP6V1G2 (NM_001204078) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ATP6G; ATP6G2; NG38; VMA10
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329698 representing NM_001204078. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCAGTCAGTCCCAAGGTATCCAGCAGCTTCTGCAAGCTGAGAAGCGGGCAGCTGAGAAGGTGGCA GATGCCAGAAAGAGGAAGGCCCGGCGACTGAAGCAGGCTACAAGGCGCCAGGTGCAGGGCATGCAGAGC TCCCAGCAGAGAAACCGAGAGCGTGTCCTGGCCCAGCTTCTTGGCATGGTCTGCGACGTCAGGCCCCAG GTCCACCCCAACTACCGGATTTCTGCCTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001204078
Insert Size	237 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001204078.1
RefSeq Size	1483 bp
RefSeq ORF	237 bp
Locus ID	534
UniProt ID	O95670
Protein Pathways	Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
MW	9 kDa
Gene Summary	This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of three V1 domain G subunit proteins. This gene had previous gene symbols of ATP6G and ATP6G2. Alternatively spliced transcript variants encoding different isoforms have been described. Read-through transcription also exists between this gene and the downstream DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (DDX39B) gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (3) uses two alternate splice sites that result in the loss of an in-frame segment in the central coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.