SEC14 like protein 2 (SEC14L2) (NM_001204204) Human Untagged Clone

CAT#: SC329726

SEC14L2 (untagged) - Homo sapiens SEC14-like 2 (S. cerevisiae) (SEC14L2), transcript variant 3



  "NM_001204204" in other vectors (2)

CNY 2,400.00

CNY 3,140.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
SEC14L2 ( SEC14-like 2) mouse monoclonal antibody, clone OTI4H2 (formerly 4H2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C22orf6; SPF; TAP; TAP1
Vector pCMV6-Entry
Sequence Data
>SC329726 representing NM_001204204.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCGGCAGAGTCGGCGATCTGAGCCCCAGGCAGAAGGAGGCATTGGCCAAGTTTCGGGAGAATGTC
CAGGATGTGCTGCCGGCCCTGCCGAATCCAGATGACTATTTTCTCCTGCGTTGGCTCCGAGCCAGAAGC
TTCGACCTGCAGAAGTCGGAGGCCATGCTCCGGAAGTTGGGGAGGAAGGTGGAGACCATCACCATAATT
TATGACTGCGAGGGGCTTGGCCTCAAGCATCTCTGGAAGCCTGCTGTGGAGGCCTATGGAGAGTTTCTC
TGCATGTTTGAGGAAAATTATCCCGAAACACTGAAGCGTCTTTTTGTTGTTAAAGCCCCCAAACTGTTT
CCTGTGGCCTATAACCTCATCAAACCCTTCCTGAGTGAGGACACTCGTAAGAAGATCATGGTCCTGGGA
GCAAATTGGAAGGAGGTTTTACTGAAACATATCAGCCCTGACCAGGTGCCTGTGGAGTATGGGGGCACC
ATGACTGACCCTGATGGAAACCCCAAGTGCAAATCCAAGATCAACTACGGGGGTGACATCCCCAGGAAG
TATTATGTGCGAGACCAGGTGAAACAGCAGTATGAACACAGCGTGCAGATTTCCCGTGGCTCCTCCCAC
CAAGTGGAGTATGAGATCCTCTTCCCTGGCTGTGTCCTCAGGTGGCAGTTTATGTCAGATGGAGCGGAT
GTTGGTTTTGGGATTTTCCTGAAGACCAAGATGGGAGAGAGGCAGCGGGCAGGGGAGATGACAGAGGTG
CTGCCCAACCAGAGGTACAACTCCCACCTGGTCCCTGAAGATGGGACCCTCACCTGCAGTGATCCTGGC
ATCTATGTCCTGCGGTTTGACAACACCTACAGCTTCATTCATGCCAAGAAGGTCAATTTCACTGTGGAG
GTCCTGCTTCCAGACAAAGCCTCAGAAGAGAAGATGAAACAGCTGGGGGCAGGCACCCCGAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001204204
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204204.1
RefSeq Size 4054 bp
RefSeq ORF 963 bp
Locus ID 23541
UniProt ID O76054
Protein Families Transcription Factors
MW 36.6 kDa
Gene Summary This gene encodes a cytosolic protein which belongs to a family of lipid-binding proteins including Sec14p, alpha-tocopherol transfer protein, and cellular retinol-binding protein. The encoded protein stimulates squalene monooxygenase which is a downstream enzyme in the cholesterol biosynthetic pathway. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (3) lacks two in-frame exons in the coding region, compared to variant 1. The encoded protein (isoform 3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...