Natriuretic Peptide Receptor C (NPR3) (NM_001204376) Human Untagged Clone

CAT#: SC329742

NPR3 (untagged) - Homo sapiens natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) (NPR3), transcript variant 3



  "NM_001204376" in other vectors (2)

CNY 3,140.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-NPR3 (Natriuretic Peptide Receptor C) mouse monoclonal antibody, clone OTI4C3 (formerly 4C3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANP-C; ANPR-C; ANPRC; C5orf23; GUCY2B; NPR-C; NPRC
Vector pCMV6-Entry
Sequence Data
>SC329742 representing NM_001204376.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCCATCTGCACTGGGACCTTGGTCCTTGTTCCCTGACCTTGCGCCGAGGGACCAGGAAGGTCAG
GTGCTCGCCCCGCGTCGGTGCTTCAGGAGGGAATGTGGCCAGAACGAGAAAGTGGTGATCATGTGTGCG
AGCAGTGACACCATCCGGAGCATCATGCTGGTGGCGCACAGGCATGGCATGACCAGTGGAGACTACGCC
TTCTTCAACATTGAGCTCTTCAACAGCTCTTCCTATGGAGATGGCTCATGGAAGAGAGGAGACAAACAC
GACTTTGAAGCTAAGCAAGCATACTCGTCCCTCCAGACAGTCACTCTACTGAGGACAGTGAAACCTGAG
TTTGAGAAGTTTTCCATGGAGGTGAAAAGTTCAGTTGAGAAACAAGGGCTCAATATGGAGGATTACGTT
AACATGTTTGTTGAAGGATTCCACGATGCCATCCTCCTCTACGTCTTGGCTCTACATGAAGTACTCAGA
GCTGGTTACAGCAAAAAGGATGGAGGGAAAATTATACAGCAGACTTGGAACAGAACATTTGAAGGTATC
GCCGGGCAGGTGTCCATAGATGCCAACGGAGACCGATATGGGGATTTCTCTGTGATTGCCATGACTGAT
GTGGAGGCGGGCACCCAGGAGGTTATTGGTGATTATTTTGGAAAAGAAGGTCGTTTTGAAATGCGGCCG
AATGTCAAATATCCTTGGGGCCCTTTAAAACTGAGAATAGATGAAAACCGAATTGTAGAGCATACAAAC
AGCTCTCCCTGCAAATCATGTGGCCTAGAAGAATCGGCAGTGACAGGAATTGTCGTGGGGGCTTTACTA
GGAGCTGGCTTGCTAATGGCCTTCTACTTTTTCAGGAAGAAATACAGAATAACCATTGAGAGGCGAACC
CAGCAAGAAGAAAGTAACCTTGGAAAACATCGGGAATTACGGGAAGATTCCATCAGATCCCATTTTTCA
GTAGCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001204376
Insert Size 975 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204376.1
RefSeq Size 6380 bp
RefSeq ORF 975 bp
Locus ID 4883
UniProt ID P17342
Protein Families Druggable Genome, Transmembrane
MW 36.7 kDa
Gene Summary This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Natriuretic Peptide Receptor C产品

Customer Reviews 
Loading...