TROY (TNFRSF19) (NM_001204458) Human Untagged Clone

CAT#: SC329756

TNFRSF19 (untagged) - Homo sapiens tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 3



  "NM_001204458" in other vectors (2)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TNFRSF19 mouse monoclonal antibody,clone OTI1B7
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TAJ; TAJ-alpha; TRADE; TROY
Vector pCMV6-Entry
Sequence Data
>SC329756 representing NM_001204458.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTTTAAAAGTGCTACTAGAACAAGAGAAAACGTTTTTCACTCTTTTAGTATTACTAGGCTATTTG
TCATGTAAAGTGACTTGTGAATCAGGAGACTGTAGACAGCAAGAATTCAGGGATCGGTCTGGAAACTGT
GTTCCCTGCAACCAGTGTGGGCCAGGCATGGAGTTGTCTAAGGAATGTGGCTTCGGCTATGGGGAGGAT
GCACAGTGTGTGACGTGCCGGCTGCACAGGTTCAAGGAGGACTGGGGCTTCCAGAAATGCAAGCCCTGT
CTGGACTGCGCAGTGGTGAACCGCTTTCAGAAGGCAAATTGTTCAGCCACCAGTGATGCCATCTGCGGG
GACTGCTTGCCAGGATTTTATAGGAAGACGAAACTTGTCGGCTTTCAAGACATGGAGTGTGTGCCTTGT
GGAGACCCTCCTCCTCCTTACGAACCGCACTGTGCCAGCAAGGTCAACCTCGTGAAGATCGCGTCCACG
GCCTCCAGCCCACGGGACACGGCGCTGGCTGCCGTTATCTGCAGCGCTCTGGCCACCGTCCTGCTGGCC
CTGCTCATCCTCTGTGTCATCTATTGTAAGAGACAGTTTATGGAGAAGAAACCCAGCTGGTCTCTGCGG
TCACAGGACATTCAGTACAACGGCTCTGAGCTGTCGTGTTTTGACAGACCTCAGCTCCACGAATATGCC
CACAGAGCCTGCTGCCAGTGCCGCCGTGACTCAGTGCAGACCTGCGGGCCGGTGCGCTTGCTCCCATCC
ATGTGCTGTGAGGAGGCCTGCAGCCCCAACCCGGCGACTCTTGGTTGTGGGGTGCATTCTGCAGCCAGT
CTTCAGGCAAGAAACGCAGGCCCAGCCGGGGAGATGGTGCCGACTTTCTTCGGATCCCTCACGCAGTCC
ATCTGTGGCGAGTTTTCAGATGCCTGGCCTCTGATGCAGAATCCCATGGGTGGTGACAACATCTCTTTT
TGTGACTCTTATCCTGAACTCACTGGAGAAGACATTCATTCTCTCAATCCAGAACTTGAAAGCTCAACG
TCTTTGGATTCAAATAGCAGTCAAGATTTGGTTGGTGGGGCTGTTCCAGTCCAGTCTCATTCTGAAAAC
TTTACAGCAGCTACTGATTTATCTAGATATAACAACACACTGGTAGAATCAGCATCAACTCAGGATGCA
CTAACTATGAGAAGCCAGCTAGATCAGGAGAGTGGTGCTGTCATCCACCCAGCCACTCAGACGTCCCTC
CAGGAAGCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001204458
Insert Size 1254 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204458.1
RefSeq Size 4214 bp
RefSeq ORF 1254 bp
Locus ID 55504
UniProt ID Q9NS68
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction
MW 45.3 kDa
Gene Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 3' coding region and the 3' UTR, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform (1). Variants 2 and 3 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...