MDM1 (NM_001205029) Human Untagged Clone

CAT#: SC329784

MDM1 (untagged) - Homo sapiens Mdm1 nuclear protein homolog (mouse) (MDM1), transcript variant 3



  "NM_001205029" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MDM1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC329784 representing NM_001205029.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCGGTGCGCTTCAAGGGGCTGAGTGAATACCAGAGGAACTTCCTGTGGAAAAAGTCTTATTTGTCC
GAGTCTTGTAATTCCTCCGTGGGGCGAAAGTACCCATGGGCTGGACTTAGATCAGATCAATTAGGAAAT
CAAGGCAGATGTAGAACCAAGATCCAGCACAGTGACATCTCATCCCTTCTCATCTTGGTCTGCTCCACA
TAA

Restriction Sites SgfI-MluI     
ACCN NM_001205029
Insert Size 210 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001205029.1
RefSeq Size 2790 bp
RefSeq ORF 210 bp
Locus ID 56890
UniProt ID Q8TC05
Protein Families Druggable Genome
MW 7.9 kDa
Gene Summary This gene encodes a microtubule-binding nuclear protein that localizes to the centrioles of dividing cells and differentiating multiciliated cells and negatively regulates centriole duplication. The encoded protein is closely associated with the centriole barrel, and resides in the centriole lumen. Naturally-occurring mutations in the orthologous mouse gene are associated with age-related retinal degeneration. [provided by RefSeq, Feb 2019]
Transcript Variant: This variant (3) lacks many 3' exons and differs at the 3' end compared to variant 1. This results in a frame-shift and a much shorter isoform (3) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...