ITGB3BP (NM_001206739) Human Untagged Clone
CAT#: SC329834
ITGB3BP (untagged) - Homo sapiens integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 1
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CENP-R; CENPR; HSU37139; NRIF3; TAP20 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329834 representing NM_001206739.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCTTTTGCTCCCGTTGCCCAGGCTAGAGTGCAATGGCACGATTTCCGTTCACTGCAACATCTGCTT CCCGCGTTCAAGCGATTCTCCTGCCTCAGCCTTGGGAGTAGTTGGGATTACAGTGTTAAAAGATCACTG AAGTTGGATGGTCTGTTAGAAGAAAATTCATTTGATCCTTCAAAAATCACAAGGAAGAAAAGTGTTATA ACTTATTCTCCAACAACTGGAACTTGTCAAATGAGTCTATTTGCTTCTCCCACAAGTTCTGAAGAGCAA AAGCACAGAAATGGACTATCAAATGAAAAGAGAAAAAAATTGAATCACCCCAGTTTAACTGAAAGCAAA GAATCTACAACAAAAGACAATGATGAATTCATGATGTTGCTATCAAAAGTTGAGAAATTGTCAGAAGAA ATCATGGAGATAATGCAAAATTTAAGTAGTATACAGGCTTTGGAGGGCAGTAGAGAGCTTGAAAATCTC ATTGGAATCTCCTGTGCATCACATTTCTTAAAAAGAGAAATGCAGAAAACCAAAGAACTAATGACAAAA GTGAATAAACAAAAACTGTTTGAAAAGAGTACAGGACTTCCTCACAAAGCATCACGTCATCTTGACAGC TATGAATTCCTTAAAGCCATTTTAAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001206739 |
Insert Size | 651 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001206739.1 |
RefSeq Size | 1136 bp |
RefSeq ORF | 651 bp |
Locus ID | 23421 |
UniProt ID | Q13352 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
MW | 24.7 kDa |
Gene Summary | This gene encodes a transcriptional coregulator that binds to and enhances the activity of members of the nuclear receptor families, thyroid hormone receptors and retinoid X receptors. This protein also acts as a corepressor of NF-kappaB-dependent signaling. This protein induces apoptosis in breast cancer cells through a caspase 2-mediated signaling pathway. This protein is also a component of the centromere-specific histone H3 variant nucleosome associated complex (CENP-NAC) and may be involved in mitotic progression by recruiting the histone H3 variant CENP-A to the centromere. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232164 | ITGB3BP (Myc-DDK tagged) - Homo sapiens integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 1 |
CNY 3,990.00 |
|
RG232164 | ITGB3BP (tGFP-tagged) - Homo sapiens integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 1 |
CNY 4,370.00 |
其它ITGB3BP产品